• Users Online: 152
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2019  |  Volume : 10  |  Issue : 1  |  Page : 27-43

Water-soluble version of SCR7-pyrazine inhibits DNA repair and abrogates tumor cell proliferation


1 Department of Biochemistry, Indian Institute of Science, Bengaluru, Karnataka, India
2 Department of Biochemistry, Indian Institute of Science; Institute of Bioinformatics and Applied Biotechnology, Electronic City, Bengaluru, Karnataka, India
3 Department of Studies in Chemistry, University of Mysore, Mysore, Karnataka, India
4 Department of Pharmaceutical Chemistry, KLE Academy of Higher Education and Research, KLE College of Pharmacy, Bengaluru, Karnataka, India
5 Institute of Bioinformatics and Applied Biotechnology, Electronic City, Bengaluru, Karnataka, India

Date of Web Publication22-May-2019

Correspondence Address:
Dr. Sathees C Raghavan
Department of Biochemistry, Indian Institute of Science, Bengaluru, Karnataka
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jrcr.jrcr_24_18

Rights and Permissions
  Abstract 


Aim: Mammalian DNA Ligases play pivotal role in processes such as DNA replication, recombination, and repair, which qualifies them as potent therapeutic targets to eradicate cancer cells. Recently, we have identified a small molecule inhibitor, SCR7 and its oxidized form SCR7-pyrazine (2-mercapto-6,7-diphenylpteridin-4-ol) (SCR7-P), which can inhibit nonhomologous end-joining (NHEJ) in a Ligase IV-dependent manner. In the present study, we describe a water-soluble version of ligase inhibitor, sodium salt of SCR7-P (Na-SCR7-P) and its anti-tumor effects. Materials and Methods: Water soluble version of SCR7-P was synthesised. To study the inhibitory effect of Na-SCR7-P on ligases, we did in vitro DNA end joining assays using double strand DNA substrates. For this, different concentrations of Na-SCR7-P was used along with purified ligases or cell-free extracts. Further, cytotoxicity induced by Na-SCR7-P was evaluated through trypan blue exclusion assay, JC-1 assay and cell cycle analysis. Anti-tumor activity of Na-SCR7-P was investigated in Swiss albino mice and its off-target effects were studied by conducting kidney and liver test and histological evaluation. Further, the anti-angiogenic effect of the compound was studied using in ovo chorioallantoic membrane assay. Results: Na-SCR7-P inhibited NHEJ in a Ligase IV-dependent manner. However, unlike SCR7 and SCR7-P, it blocked joining catalyzed by all three ligases in vitro, making it an ideal cancer therapeutic agent, as it may target multiple DNA transaction processes within the cancer cells. Na-SCR7-P decreased mitochondrial membrane potential (MMP) leading to cell death in cancer cells. Importantly, the administration of Na-SCR7-P led to a significant reduction in tumor growth from 12th day of treatment, and its impact was significantly higher than previously described SCR7, which targets Ligase IV within cells. Antitumor activity of Na-SCR7-P in mice resulted in enhanced lifespan, with minimal side effects. In addition, the in ovo chorioallantoic membrane assay revealed potent antiangiogenic property of Na-SCR7-P. Conclusion: Our results suggest that Na-SCR7-P can target NHEJ and other DNA repair pathways by disrupting Ligase mediated joining and can potentially be used as a strategy for cancer treatment, owing to its water solubility.

Keywords: Cancer therapeutics, CRISPR, DNA ligase, double-strand break, end-joining, genome editing, homologous recombination, nonhomologous end-joining


How to cite this article:
Pandey M, Gopalakrishnan V, Swarup HA, Kumar S, Gudapureddy R, Jose AE, Vartak SV, Sebastian R, Srivastava M, Choudhary B, Kempegowda M, Karki SS, Raghavan SC. Water-soluble version of SCR7-pyrazine inhibits DNA repair and abrogates tumor cell proliferation. J Radiat Cancer Res 2019;10:27-43

How to cite this URL:
Pandey M, Gopalakrishnan V, Swarup HA, Kumar S, Gudapureddy R, Jose AE, Vartak SV, Sebastian R, Srivastava M, Choudhary B, Kempegowda M, Karki SS, Raghavan SC. Water-soluble version of SCR7-pyrazine inhibits DNA repair and abrogates tumor cell proliferation. J Radiat Cancer Res [serial online] 2019 [cited 2019 Sep 17];10:27-43. Available from: http://www.journalrcr.org/text.asp?2019/10/1/27/258716




  Introduction Top


DNA double-strand breaks (DSBs), when misrepaired or left unrepaired can severely compromise genome integrity and could lead to consequences such as chromosomal translocations, deletions, oncogenesis or cell mortality.[1],[2],[3],[4] The DSBs can arise due to endogenous sources, which include errors in DNA physiological processes (e.g., replication across nicks, replication fork collapse or meiosis), inadvertent nuclease activities, and reactive oxygen species (ROS) and exogenous sources such as radiation.[4],[5] To maintain genome integrity, the cells depend on two major DSB repair pathways, homologous recombination (HR) and nonhomologous end-joining (NHEJ).[5],[6],[7] HR is error-free and operative only at S and G2/M phases, while NHEJ can result in small changes at joining junctions and is functional throughout the cell cycle. In addition to these, recently, an alternate highly error-prone NHEJ pathway, which is dependent on the use of microhomology was described, termed as microhomology-mediated end joining.[8],[9],[10],[11],[12] Thus, highly proficient, regulated and well-synchronized processes of DNA damage response and DNA repair pathways are essential for the maintenance of genomic integrity.

Highly efficient DNA repair pathways can provide growth advantage not only to normal cells but also to transformed cells, making them suitable targets for anti-cancer therapeutic strategies by developing small molecule inhibitors against the proteins involved in these pathways.[5] In that direction, a potent inhibitor of one of the crucial enzymes of NHEJ repair pathway, Ligase IV, known as SCR7, was identified.[13] SCR7 served as one of the best examples of anticancer therapeutic strategy targeting DSB repair, and exhibiting synergistic effects with radio and chemotherapeutic agents.[8],[13] Besides, a nanomaterial encapsulated version of SCR7 (E-SCR7) was described recently.[14],[15] E-SCR7 inhibited NHEJ and exhibited ~5-fold increase in cell death.

In addition to Ligase IV, there are other two ATP dependent DNA ligases known in mammals.[16],[17] All three DNA ligases (DNA Ligase I, III and IV) share a high degree of homology both at structural and functional levels. They possess a well-conserved catalytic domain and utilize comparable reaction mechanism to catalyze the formation of phosphodiester bond during the process of ligation. Since all the eukaryotic ATP-dependent mammalian DNA ligases descended from a common ancestor, they share a high degree of structural homology, but differ in sequence, particularly in the DNA binding domain (DBD), which is bound by small molecules, the joining activity of Ligases can be severely impaired.[18]

Our recent study shows that parental SCR7 can undergo spontaneous cyclization leading to the generation of multiple forms with comparable chemical and biological activity.[19] One such isomer that arises from autocyclization followed by oxidation of parental SCR7 is SCR7-pyrazine (SCR7-P).[19] Our study shows that similar to cyclized form of SCR7, SCR7-P inhibits NHEJ in a Ligase IV-dependent manner leading to accumulation of DSBs inside cells, which induce cell death.[19] However, we observed that SCR7-P was less specific inside the cells as it caused cell death even in Ligase IV null cells.

Besides, its use as a biochemical inhibitor, various other studies showed that SCR7 can improve the efficacy of precise genome editing by several fold when used along with CRISPR-Cas system.[8],[20],[21],[22],[23],[24],[25],[26],[27] Although SCR7 and its cyclized forms are useful at multiple levels, one of the major limitations is their solubility in DMSO or other organic solvents.

Water-soluble version of a chemical can improve its bioavailability to the cells. Therefore, we were interested in making a sodium salt of SCR7. Since, SCR7-P was most stable, among different SCR7 isomers, we selected it for the study. We rationalize that addition of sodium moiety by a replacement reaction involving Mercapto functional group in the ring A of the parent chemical can transform the molecule favorably and may improve its solubility in water.

In the present study, we have designed, synthesized and biologically evaluated the activity of water-soluble version of Ligase IV inhibitor, sodium salt of SCR7-P (Na-SCR7-P). It inhibited joining catalyzed by cell-free extracts irrespective of the type of DSBs used, suggesting inhibition of NHEJ. Although Na-SCR7-P inhibited DSB joining mediated by Ligase IV/XRCC4, it also inhibited both Ligase I and Ligase III mediated joining. Further, Na-SCR7-P treatment resulted in altered MMP activating apoptosis, finally leading to cytotoxicity in cancer cells. Importantly, Na-SCR7-P administration resulted in tumor regression leading to improved life span, without major side effects. We also observed that Na-SCR7-P affected the angiogenesis in ovo. Thus, synthesis of the water-soluble anti-cancer compound, with a higher bioavailability, could facilitate further evaluation of its anticancer properties.


  Materials and Methods Top


Chemicals and reagents

Chemicals used in the present study were of high analytical grade and purchased from Sigma-Aldrich, USA, Sisco Research Laboratories (Mumbai, India) and Amresco (Solon, OH, USA). Radioisotope-labeled nucleotides were purchased from BRIT (Hyderabad, India). DNA-modifying enzymes were from New England Biolabs (Beverly, MA, USA). Fertilized chicken embryos were from Indian Veterinary Research Institute, (Bangalore, India) and filter-paper discs (Whatman 1) were purchased from GE health care (USA).

Synthesis of sodium salt of 2-mercapto-6, 7-diphenylpteridin-4-ol

Na-SCR7-P was synthesized in a sequential manner using different reagents, taking several chemical parameters under consideration such as melting points, IR spectra, NMR spectra, mass spectra to determine the stability and purity of the compound. Melting points (MP°C) were determined by open capillary method and were uncorrected. 5,6-diamino-4-hydroxy-2-mercapto-pyrimidine was obtained from Aldrich, USA. Benzaldehyde AR grade and glacial acetic acid AR grade were from SRL, India.1 H NMR spectra of the newly synthesized compounds, in DMSO-d6 solutions, were recorded on a Bruker (400 MHz) NMR [Figure 1]. Chemical shifts are reported as δ (ppm) relative to TMS as internal standard; coupling constants (J) are expressed in Hz. Mass spectra were recorded in triple quadrupole LCMS-6410 from Agilent technologies [Figure 1].
Figure 1: (a) The synthetic route employed in obtaining the compound sodium salt of SCR7-Pyrazine. (b and c) Structural and molecular characterization of Na-SCR7-pyrazine by NMR (b) and mass spectroscopy (c)

Click here to view


Synthesis of 2-mercapto-6,7-diphenylpteridin-4-ol[

A suspension of 4,5-diamino-6­-hydroxy-2-mercaptopyrimidine[1], (0.05 mol) and benzaldehyde[2] (0.15 mol) in dimethylformamide (30 ml) and acetic acid (10 ml) were refluxed for 8 h. After cooling, contents of the reactions were added to ice cold water, and separated solid was filtered, washed with water and obtained the desired product by column chromatography using ethyl acetate-hexane 6:4. Yield: 35%. MP: 194-196°C.1 H-NMR: 13.40 (1H, s, OH), 12.80 (1H, s, SH), 7.44-7.32 (10H, m, Ar). LC-MS/MS: 331.0 (332.1).

Synthesis of sodium salt of 2-mercapto-6, 7-diphenylpteridin-4-ol[4]

0.015 mol of sodium hydroxide was dissolved in 20 ml of ethyl alcohol. To this solution, 0.01 mol of 2-mercapto-6,7-diphenylpteridin-4-ol[3] was added, and the reaction mixture was stirred overnight at room temperature. Ethyl alcohol was removed under vacuum, and the solid was dissolved in water, followed by filtering of the undissolved mass and reducing the filtrate under vacuum to get an orange colored product with 90% yield.1 H-NMR: 11.19 (1H, s, OH), 7.39-7.26 (10H, m, Ar). LC-MS/MS: 355.10 (354.06).

Oligomers and 5' end labeling

Oligomers used in the study were purchased from Sigma-Aldrich, India. Oligomers used were follows:

SCR19, 5'GATCCCTCTAGATATCGGGCCCTCGAT CCGGTACTACTCGAGCCGGCTAGC-TTCG ATGCTGCAGTCTAGCCTGAG 3'; SCR20, 5'GATCCTCAGGCTAGACTG­-CAGCATCG AAGCTAGCCGGCTCGAGTAGTACCGG ATCGAGGGCCCGATATCTAGAGG 3'; VK7, 5' GGGCTCTAGATATCGGGCCCTCG ATCCGGTACTACTCGAGCCGGCTAG-C TTCGATGCTGCAGTCTAGCCTGGCCC 3'; VK8, 5' GGGCCAGGCTAGACTGCA-GC ATCGAAGCTAGCCGGCTCGAGTAGTACC GGATCGAGGGCCCGATATCTAGAGCCC 3'; VK11, 5' AATTCTCAGGCTAGACTGC AGCATCGAAGCTAGCCGGCTCGAGTAG- TACCGGATCGAGGGCCCGATATCTAGAGG 3'; VK13, 5' GGCTAGACTGCAGCA­-TCGAAGCTAGCCGGCTCGAGTAGTACCGGATCGAGGGCCCGATATCTAGAGG 3'; MS68, 5' ATCCGTTGAAGCCTGCTT 3'; MS69, 5' TGACATACTAACTTGAGCGAAACGG 3'; MS70, 5' CCGTTTCGCTCAAGTTAGTATGTCAAAGCAG GCTTCAACGGAT 3'.

Oligomers were purified as described earlier.[28] Briefly, oligomers were resuspended in TE buffer, gel purified on denaturing polyacrylamide gel electrophoresis (PAGE; 12%–15%). The 5′ end-labeling of the gel purified oligomeric DNA with (γ−32 P) ATP was performed using T4 Polynucleotide Kinase.[28],[29] To prepare the nicked DNA substrate, radiolabelled MS68 was annealed to cold (5' phosphorylated) MS69 and MS70 in the presence of 100 mM NaCl and 1 mM ethylenediaminetetraacetic acid (EDTA). Similarly, for studying NHEJ, different DSB possessing substrates were generated. To prepare the 5'-5' compatible DSB DNA substrate, radiolabelled SCR19 was annealed to cold (5' phosphorylated) SCR20. Radiolabeled SCR19 was also annealed to VK11 or VK13 to make 5'-5' and 5'-3' noncompatible ends, respectively.

Plasmids and bacterial strains

Ligase I, Ligase IIIα/XRCC1 and Ligase IV/XRCC4 were overexpressed in  Escherichia More Details coli and purified. Plasmid coexpressing Ligase IV and XRCC4 was a kind gift from Dr. Mauro Modesti (France). Plasmid DNA harboring DNA Ligase I (pET24a-Ligase I) was a kind gift from Dr. A. Tomkinson (USA). DNA Ligase IIIα/XRCC1 coexpression vector (pSS6) was generated by cloning Ligase IIIα, released from pcDNA3.1-Lig3α with SalI-NotI into pSS5.[13] Rosetta (DE3) pLysS and BL21 (DE3) pLysS cells were purchased from Novagen (USA).

Cell lines and culture

MCF7 and T47D (human breast cancer), HeLa (human cervical cancer), Molt4 (T-cell leukemia) and HEK293T (human kidney epithelial cells) cells were purchased from National Center for Cell Science, Pune, India. REH and Nalm6 cells (B-cell leukemia), and CEM (T-cell leukemia) were from M. Lieber, USA and were cultured in RPMI1640 (Sera Lab, UK). MCF7 and T47D were cultured in MEM with L-glutamine, Molt4 in RPMI1640, while HeLa cells were grown in DMEM with L-glutamine. The cell culture media was supplemented with 10% Fetal bovine serum (Gibco BRL, USA), 100 μg/ml penicillin and 100 μg/ml streptomycin (Sigma–Aldrich, USA). The cells were grown at 37°C in a humidified atmosphere containing 5% CO2.

In vivo experiments

Ethics statement

Mice were maintained as per the principles and guidelines of the ethical committee for animal care of Indian Institute of Science in accordance with the Indian National Law on animal care and use. The experimental design of the present study was approved by Institutional Animal Ethics Committee (Ref. CAF/Ethics/229/2011), Indian Institute of Science, Bengaluru, India.

Animals

Male Swiss albino mice, 3–4 weeks old, and male rats (Rattus norvegicus) strain Wistar, 4–6 weeks old, were purchased from central animal facility, Indian Institute of Science, India and were maintained as per the guidelines of the Animal Ethical Committee in accordance with Indian National Law on animal care and use. The animals were housed in polypropylene cages and provided standard pellet diet (Agro Corporation Pvt. Ltd., Bengaluru, India) and water ad libitum. The standard pellet diet is composed of 21% protein, 5% lipids, 4% crude fiber, 8% ash, 1% calcium, 0.6% phosphorus, 3.4% glucose, 2% vitamin, and 55% nitrogen-free extract (carbohydrates). The animals were maintained under controlled conditions of temperature and humidity with a 12 h light/dark cycle.

Preparation of Ehrlich ascites carcinoma or Dalton's lymphoma cells

Ehrlich ascites carcinoma (EAC) or Dalton's lymphoma (DLA) cells were collected from the peritoneal cavity of ascites-bearing donor mice of 20–22 g body weight and suspended in sterile phosphate buffered saline (PBS). A fixed number of viable cells (10 × 106 cells/22 g body weight) were implanted into the peritoneal cavity of each recipient mouse and allowed to multiply. The tumor cells were withdrawn, diluted in saline, counted and reinjected (1 × 106 cells/animal) to right thigh tissue of experimental animals for developing solid tumor over a period of 10–12 days.

Evaluation of antitumor activity of sodium salt of SCR7-pyrazine in mice

To study the antitumor activity of Na-SCR7-P, 30 Swiss albino mice were used, (5 animals each in three groups including no tumor control; 2 batches). Among 30 mice, 20 were injected with EAC cells (1 × 106) to induce solid tumor in thigh region and was allowed to grow up to 10–12 days, following which 10 tumor-bearing mice received 1X PBS as vehicle control, while the other 10 received intraperitoneal administration of Na-SCR7-P (10 mg/kg, body weight) on every alternative day starting from 12th day of injection of tumor cells. Similarly, 24 Swiss albino mice were used (4 animals each 3 groups; in 2 batches) for assessing the anti-tumor property of Na-SCR7-P in DLA tumor mouse models. Among that, 16 were injected with DLA cells (1 × 106) to induce solid tumor in thigh region and was allowed to grow for the same period, following which 8 tumor-bearing mice received 1X PBS as vehicle control, while the other 8 received intraperitoneal administration of Na-SCR7-P (10 mg/kg, b. wt; 6 doses every alternate day from 12th day posttumor cell injection). Eight mice served as untreated normal control. The diameters of developing tumor were measured in the case of group two and three animals by using vernier calipers once in 2 days. Tumor volume was calculated using the formula V = 0.5.a. b 2, where “a” and “b” indicate the major and minor diameter, respectively.[30],[31],[32],[33] At the end of 25th day of the experimental period, one animal from each group per batch was sacrificed by cervical dislocation and organs from normal (Group 1), tumor (Group 2), and Na-SCR7-P treated (Group 3) animals were collected and stored. To check the longevity, the percentage of increase in lifespan was calculated and compared with that of control animals. The death pattern for controls and Na-SCR7-P treated animals was recorded and percentage increase in lifespan was calculated using the formula ([T2C]/C) × 100, where “T” indicates the number of days the Na-SCR7-P treated animals survived and “C” indicates the number of days tumor animals survived.[13],[30],[31]

Evaluation of off-target effects of sodium salt of SCR7-pyrazin in normal mice

Swiss albino mice (2 groups, 5 each) were treated with Na-SCR7-P (6 doses, on every alternate day) and side effects were evaluated post 25th day of treatment. Of 10 mice, 5 animals served as control and injected with 1X PBS, while 5 were treated with Na-SCR7-P (10 mg/kg body weight 6 doses, every alternate day). Body weight of each animal was monitored throughout the experiment, and average weight was calculated at 25th day for control and Na-SCR7-P administered mice and were plotted with error bars. To evaluate the effect of Na-SCR7-P on physiological functions, blood was collected on the 25th day as described earlier.[13],[32] Blood was drawn from heart and the serum and plasma were separated in the presence of heparin (10 μl) to conduct liver and kidney function tests for each animal, to determine the levels of alkaline phosphatase (ALP), creatinine and urea present in serum of treated and control animals, while red blood cell (RBC), and white blood cell (WBC) counting was carried out using plasma of treated and control animals as described earlier.[13],[32] Values are presented as mean ± standard error of mean (SEM).

Histological evaluation

Tumor, liver, and spleen tissues of normal, untreated EAC tumor-bearing and Na-SCR7-P treated experimental mice were collected and processed as per standard protocols.[30],[31],[33] Briefly, the tissues were embedded in paraffin wax, sectioned at 5–10 μm in a rotary microtome (Leica Biosystems, Germany) and stained with hematoxylin and eosin.[13],[32] Each section was evaluated by light microscopy (×20), and images were captured (Zeiss, Germany).

Chorioallantoic membrane assay

Chorioallantoic membrane (CAM) assay was performed as described earlier with modifications.[34],[35] The fertilized eggs were first incubated at 37°C, for them to grow up to 4-day stage. Then, a small window was created in the shell of the eggs and further incubated at 37°C (Rh of >80%). After 9–10 days of development, with a well-established network of blood vessels on the CAM, the filter disks soaked with different concentrations of Na-SCR7-P (10, 50, 100, and 250 μM) were placed gently with the help of sterile forceps inside each egg, precisely on the membrane. The filter paper disk soaked in 70% ethanol served as the vehicle control (70% ethanol was preferred over water/1X PBS as vehicle control as it accelerates the evaporation of spotted compound on the filter paper discs). After 48 h of incubation at 37°C, the discs were removed, and the effect of Na-SCR7-P on the development of new blood vessels (sparing the main vasculature) was captured using Zeiss microscope and then was analyzed both qualitatively and quantitatively.

Preparation of cell-free extract

The cell-free extracts were prepared as described earlier.[36],[37],[38] Testes were collected from [8],[9],[10] rats (R. norvegicus) strain Wistar (4–6 weeks old). Approximately, 8 × 107 cells were resuspended in hypotonic buffer (Buffer A: 10 mM Tris-HCl [pH 8.0], 1 mM EDTA, 5 mM DTT, and 0.5 mM PMSF) and homogenized in the presence of protease inhibitors (1 μg/ml each of leupeptin, aprotinin, and pepstatin). Buffer B (50 mM Tris-HCl [pH 8.0], 10 mM MgCl2, 2 mM DTT, 0.5 mM PMSF, 25% sucrose, and 50% glycerol) was added and incubated on ice for 30 min, followed by addition of neutralized, saturated ammonium sulfate solution and incubating for 30 min at 4°C. The lysate was then ultracentrifuged at 95,000 g, at 4°C for 3 h in a Beckman TLA-100 Rotor (Beckman, Palo Alto, USA). Following ammonium sulfate precipitation (65%), pellet was collected, dissolved in dialysis buffer (Buffer C: 25 mM HEPES-KOH [pH 7.9], 100 mM KCl, 0.1 M KOAc, 12 mM MgCl2, 1 mM EDTA, 2 mM DTT and 17% glycerol) and then dialyzed against dialysis buffer (20 mM Tris-HCl (pH 8.0), 0.1 M KOAc, 20% glycerol, 0.5 mM EDTA, and 1 mM DTT), snap frozen and stored at −80°C. The protein concentration was determined by Bradford's method. Protein amount was normalized further by loading on SDS polyacrylamide gel, followed by staining with Coomassie Brilliant Blue.

Over expression and purification of mammalian DNA ligases

For expression of proteins, bacterial cells were transformed with appropriate expression vectors, induced by addition of 0.5–1 mM IPTG (16 h at 16°C). Proteins were purified as described earlier.[13],[39] Briefly, cells were harvested, lysates were prepared with the extraction buffer (20 mM Tris–HCl [pH 8.0], 0.5 M KCl, 20 mM imidazole [pH 7.0], 20 mM β-mercaptoethanol, 10% glycerol, 0.2% Tween 20, 1 mM PMSF) and loaded on Ni-NTA column as per manufacturer's instructions (Novagen). Fractions were collected, purest fractions were pooled and reloaded on to UNO sphere Q anion or S cation exchange column (BioRad), following which the protein was eluted by gradient of KCl. Appropriate fractions were pooled, dialyzed (Dialysis buffer: 20 mM Tris-HCl [pH 8.0], 150 mM KCl, 2 mM DTT, and 10% glycerol) and stored at −80°C. Purity and identity of the proteins were confirmed by SDS-PAGE (CBB and silver stain) and western blotting with appropriate antibodies.

Ligase I purification was done as described earlier.[39],[40] Briefly, for efficient expression of DNA Ligase I, BL21 E. coli (DE3) pLysS bacterial cells were transformed with pET24a-Ligase I and then induced by addition of 0.5 mM IPTG (18 h at 16°C) in the presence of Chloramphenicol (33 μg/μl) and Kanamycin (30 μg/μl). After induction, the cells were harvested, extracts were prepared with the extraction buffer (20 mM Tris–HCl [pH 8.0], 0.5 M KCl, 20 mM imidazole [pH 7.0], 20 mM β-mercaptoethanol, 10% glycerol, 0.2% Tween 20 and 1 mM PMSF) and loaded onto phosphocellulose column as per manufacturer's instructions (BioRad, USA). Multiple fractions were eluted and collected using a gradient of NaCl. The purest fractions from the first column were pooled together and reloaded on to UNO sphere Q anion exchange column (BioRad), following which the protein was eluted by gradient of KCl. Appropriate fractions containing Ligase I were then pooled again, dialyzed (Dialysis buffer: 20 mM Tris-HCl [pH 8.0], 150 mM KCl, 2 mM DTT, and 10% glycerol) and stored at −80°C. Purity and identity of Ligase I was confirmed by SDS-PAGE and/or by immunoblotting with appropriate antibodies.

The purification of DNA Ligase IV/XRCC4 and XRCC1/Ligase IIIa was carried out as described earlier.[13] The purity of the proteins was confirmed with SDS-PAGE followed by silver staining or CBB staining, and identity was confirmed by immunoblotting.

In vitro DNA end joining assay using ds DNA substrates

In vitro joining assay was performed as described, with modifications.[36],[38],[41] Different concentrations Na-SCR7-P (0, 50, 100, 200, 500, 1000 μM) were first incubated with equimolar concentrations of DNA Ligase IV/XRCC4 (2 nmol) or cell-free extracts (1 μg) in a buffer containing 25 mM Tris-HCl (pH 7.5), 75 mM NaCl, 10 mM MgCl2, 42.5 mM KCl, 0.025% Triton X-100, 100 μg/ml BSA, 1 mM ATP 10% PEG and 5% glycerol in a reaction volume of 10 μl and incubated at 25°C for 30 min. Then radiolabeled ds DNA substrates with varying ends (5' compatible or 5'-5' or 5'-3' noncompatible) (6 nM) were added to the mix and incubated at 25°C for another 1 h. In case of reactions were noncompatible end substrates were used, the buffer was supplemented with dNTPs. In control reaction, IX PBS equivalent to the highest concentration of inhibitor used was incubated along with the DNA and protein. Reactions were terminated by addition of 4 mM EDTA. Reaction products were deproteinized, precipitated and resolved on an 8% denaturing urea PAGE. The gel was dried and exposed, and the signal was detected using a PhosphorImager (FLA9000, Fuji, Japan) and analyzed with Multi Gauge Version 3.0 software (Bioz, Inc., California, USA). For quantification of joined products, the area corresponding to the band of interest was selected in each lane, and the same sized rectangle was selected in an area with no band from each lane of the gel for subtracting background. Intensity measured from each lane was indicated as photostimulated luminescence units and plotted.

Radiolabeled nicked duplex DNA substrate (6 nM) was incubated with purified Ligase III/XRCC1 (2 nmol) or DNA Ligase I (4 nmol), in presence of increasing concentrations of inhibitors (0, 50, 100, 200, 500 and 1000 μM) in a buffer containing 25 mM Tris-HCl [pH 7.5], 75 mM NaCl, 10 mM MgCl2, 42.5 mM KCl, 0.025% Triton X-100, 100 μg/ml BSA, 1 mM ATP, 10% PEG and 5% glycerol (25°C for 30 min). Nicked DNA substrate was then added to the reaction mixture and incubated further at 25°C for 1 h. Reactions were terminated, joined products were purified and resolved on an 8% denaturing PAGE. The radioactive signal was detected using a PhosphorImager (FLA9000, Fuji, Japan) as described above. Quantification of joined products was also performed as described above.

Effects of sodium salt of SCR7-pyrazine on double-strand break joining by purified T4 DNA ligase

5' compatible duplex DNA substrates were generated by annealing radioactively labeled SCR19 with unlabelled SCR20. Keeping the protein concentration constant (5 U), increasing amount of inhibitors were added (0, 50, 100, 200, 500 and 1000 μM) in a reaction buffer containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 1 mM ATP and 10 mM DTT, incubated at 25°C for 30 min. DSB containing radiolabeled DNA was then added (6 nM) and incubated further for 25°C for 1 h. Reactions were terminated, joined products were purified, resolved on an 8% denaturing PAGE and quantified as described above.

Trypan blue dye exclusion assay

Na-SCR7-P was analyzed for its inhibitory effects on various cancer cells (REH, Nalm6, T47D, MCF7, and HeLa) proliferation by performing trypan blue dye exclusion assays.[33],[42],[43] Briefly mammalian cells (0.5 × 105 cells/ml) were cultured for 24 h, followed by addition of compounds (0, 10, 50, 100 and 250 μM for 48 h). Cells were harvested and subjected to trypan blue (0.4%) cell viability assay. 1X PBS treated cells were used as vehicle control. Each experiment was repeated a minimum of three independent times. IC50 values were calculated post 48 h of treatment in normal and cancer cells using Graph Pad Prism version 5 (Graph Pad, California, San Diago, USA).

Cell cycle analyses by flow cytometry

Cell cycle analysis was performed as described previously.[44],[45] Briefly, MCF7 cells were cultured (50,000 cells/ml) for 24 h and then treated with increasing concentrations of Na-SCR7-P (0, 10, 50, 100 and 250 μM). After 48 h of treatment, cells were harvested, washed and permeabilized using chilled 80% ethanol at −80°C overnight. The fixed cells were centrifuged at 3,000 rpm, washed and resuspended in ice cold 1X PBS. RNase A (50 μg/ml) was added and incubated at 37°C overnight. Following day, propidium iodide (PI, 50 μg/ml) was added and analyzed using flow cytometer (BD Biosciences, FACS Verse, USA). A minimum of 10,000 cells were acquired in each case and analyzed using WinMDI 2.9 (The Scripps Institute, Flow Cytometry Core Facility, La Jolla, USA) and Flowing Software 2.5 (Turku Centre for Biotechnology, Turku, Finland).

Detection of intracellular reactive oxygen species production by flow cytometry

The level of total intracellular ROS production was measured by using cell-permeable fluorescent probe 2,7-dichlorodihydrofluorescein diacetate (H2DCFDA) in MCF7 cells. Cells were treated with 100 μM of Na-SCR7-P for 5, 10, 30 and 60 min, harvested, washed and the fluorescence intensity was analyzed by flow cytometry. Cells treated with H2O2 were used as positive control for compensation of experimental samples.

Determination of mitochondrial membrane potential

MCF7 cells stained with JC-1 dye were used for determining the changes in MMP.[31],[46] Briefly, cells were treated with Na-SCR7-P (10, 50, 100 and 250 μM), harvested (48 h) and incubated with JC-1 dye (5,5′, 6, 6 tetrachloro-1,1′, 3, 3′-tetraethylbenzimidazol-carbocyanine iodide). The stained cells were then analyzed on a flow cytometer using Cell Quest Pro software (BD Bioscience, San Jose, California, USA) with an excitation at 488 nm and emission at 530 nm. JC-1 monomers emit at 530 nm (red), and J-aggregates emit at 590 nm (green). The ratio of cells emitting red to green fluorescence was evaluated for each dose and plotted. 2, 4-Dinitrophenol-treated cells served as positive control.

Statistical analysis

Values are expressed as mean ± SEM for control and experimental samples, and statistical analyses were performed by one-way ANOVA followed by paired Student's t-test with GraphPad software prism 6 (Graph Pad, California, San Diago, USA).[9] Animal survival analysis was done using Kaplan-Meier estimate.


  Results Top


Synthesis and characterization of sodium salt of SCR7-pyrazine

Recently, we showed that parental SCR7 and its stable autocyclized form (referred to as SCR7, henceforth) are structural isomers and they possess identical chemical formula (C18H14N4 OS), molecular weight, exact mass, and same number of protons.[19] We observed that like parental SCR7, cyclized form possessed a melting point of 221°C–225°C, while it was 194°C–196°C for SCR7-P, the oxidized form of SCR7. Unlike cyclized form of SCR7, the SCR7-P possessed a distinct structure with an exact mass of 333.0798, molecular weight (332.0732) and chemical formula (C18H12N4 OS).[19]

Synthesis of water-soluble version of chemical inhibitors is important as the strategy can make the drug delivery easier and efficient with minimal toxicity. In the present study, a water-soluble version of SCR7-P was synthesized by preparing its sodium salt. To do this, first SCR7-P was synthesized as described earlier and characterized.[19] The sodium salt of SCR7-P (Na-SCR7-P, 2-mercapto-6,7-diphenylpteridin-4-ol) was prepared by adding sodium hydroxide solution to 2-mercapto-6, 7-diphenylpteridin-4-ol with a 90% yield [Figure 1]a. Na-SCR7-P has a molecular weight of 354.06 and exhibited a melting point of 192°C–194°C.1 H NMR spectrum and mass spectrum of the newly synthesized compound confirmed the structure [Figure 1]b and [Figure 1]c.

Sodium salt of SCR7-pyrazine inhibits DNA end joining of diverse double-strand breaks catalyzed by cell-free extracts

We examined the efficacy of Na-SCR7-P to inhibit DSB joining catalyzed by rat testicular cell-free extracts. A previously described NHEJ assay was used to evaluate DNA end-to-end joining to assess the effect of inhibitor on NHEJ [Figure 2]a.[13],[37],[38],[47] In order to examine the effect of Na-SCR7-P on ligation of DSB with easily ligatable 5'-5' compatible overhangs, (γ-32 P) ATP labeled DNA substrates were incubated with cell-free extracts (1 μg; 1 h at 25°C), which were pre-incubated with increasing concentrations of inhibitors (0, 50, 100, 200, 500 and 1000 μM; 30 min at 25°C). A concentration-dependent inhibition of end joining was observed in the presence of Na-SCR7-P from 100 μM onwards, suggesting abrogation of DSB joining in the presence of the inhibitor [Figure 2]b and [Figure 2]c. DNA end processing is obligatory during the joining of 5'-5' or 5'-3' noncompatible ends, which requires complex NHEJ machinery as shown earlier.[37],[38],[47] Interestingly, we observed that Na-SCR7-P inhibited NHEJ reaction efficiently in a concentration-dependent manner [Figure 2]d and [Figure 2]e. In fact, the observed effect was more pronounced when compared with SCR7 or SCR7-P.[13],[19] Hence, our results suggest that Na-SCR7-P inhibited end joining of broken DNA, irrespective of the configuration of DSBs.
Figure 2: The effect of sodium salt of SCR7-pyrazine on DNA end joining catalyzed by rat testicular cell-free extracts. (a) Schematic representation of nonhomologous end-joining assay in the presence of inhibitor. (b) Effect of increasing concentrations of the sodium salt of SCR7-pyrazine (0, 50, 100, 200, 500, and 1000 μM) on end joining of double-strand breaks bearing 5'-5' compatible ends, catalyzed by cell-free extracts from rat testes (25°C for 60 min). (c) Bar diagram showing quantification of the inhibition of joining of 5'-5' compatible end substrates by sodium salt of SCR7-pyrazine, based on the three independent experiments. (d) Effect of increasing concentrations of sodium salt of SCR7-pyrazine (0, 50, 100, 200, 500, and 1000 μM) on double-strand break joining of 5'-3' or 5'-5' noncompatible end structures, catalyzed by rat testicular cell-free extracts (25°C, 60 min). (e) Bar diagram representing quantification of inhibition of joining of double-strand breaks containing either 5'-3' (upper) or 5'-5' (lower) noncompatible termini in the presence of sodium salt of SCR7-pyrazine on a minimum of two independent experiments. In all panels, the concentrations of sodium salt of SCR7-pyrazine used are indicated. Joining products are indicated. 'M' is 50 bp ladder. No protein control (lane 1, 8) and joining in the presence of vehicle control (1X phosphate buffered saline, lanes 2, 9) is also shown. In all panels, error bars represent standard error of mean and P value indicates, *P < 0.05; **P < 0.01; NS: Non-significant

Click here to view


Sodium salt of SCR7-pyrazine inhibits joining catalyzed by Ligase IV/XRCC4, Ligase III/XRCC1 and Ligase I

The enzyme Ligase IV/XRCC4 complex can efficiently join 5'-5' compatible DNA ends,[13],[48] whereas joining of noncompatible termini requires processing by additional factors involved in NHEJ repair pathway.[37],[38],[47] To further examine whether Na-SCR7-P interfered with Ligase IV activity, we used purified Ligase IV/XRCC4 (2 nmol) for in vitro joining assay. Results showed that incubation with increasing concentrations of Na-SCR7-P resulted in the inhibition of product formation from 200 μM onwards [Figure 3]a. The effect of Na-SCR7-P on joining of DNA breaks catalyzed by T4 DNA ligase, and other two mammalian ligases (Ligase I and III) were also examined. While there was no reduction in the joining efficiency in case of T4 DNA Ligase, specific inhibition of nicked DNA joining was observed in the cases of purified Ligase III/XRCC1 (2 nM) and Ligase I (2 nM) when used in equimolar concentrations [Figure 3]b, [Figure 3]c, [Figure 3]d. Therefore, unlike SCR7, Na-SCR7-P inhibited joining catalyzed by all three ligases.
Figure 3: Effect of the sodium salt of SCR7-pyrazine on joining by Ligase IV/XRCC4, Ligase IIIα/XRCC1, Ligase I and T4 DNA Ligase. (a) The evaluation of the inhibitory effect of increasing concentrations of sodium salt of SCR7-pyrazine (0, 10, 50, 100, 200, 500, and 1000 μM) on Ligase IV-mediated joining of DNA containing 5'-5' compatible ends. DNA Ligase IV/XRCC4 complex was purified and used for the study. DNA Ligase IV-mediated joining in the presence of 1X phosphate buffered saline is shown (lane 2, 3). (b and c) Evaluation of the inhibitory effect of increasing concentrations of sodium salt of SCR7-pyrazine (0, 50, 100, 200, 500, and 1000 μM) on joining of nicked duplex DNA substrate, catalyzed by either purified DNA Ligase III/XRCC1 (b) or DNA Ligase I. (c and d) The analysis of inhibitory effect of increasing concentrations of sodium salt of SCR7-pyrazine (0, 50, 100, 200, 500, and 1000 μM) on joining of DNA substrate containing 5'-5' compatible ends catalyzed by T4 DNA Ligase. In all panels, inhibition due to the addition of sodium salt of SCR7-pyrazine to respective DNA Ligase mediated joining is quantified and presented. Lane 1 is DNA substrate alone (no protein added). In panels, (a-d) control joining reaction in the absence of inhibitor is shown (lane 2). 'M' is 50 bp ladder. The joined products are indicated in all panels. Error bars represent standard error of mean and P value indicates, *P < 0.05; **P < 0.01; ***P < 0.001

Click here to view


Sodium salt of SCR7-pyrazine induces cytotoxicity in various cancer cells

To evaluate whether Na-SCR7-P treatment leads to cytotoxicity in different cancer cell lines, ex vivo studies were performed on various mammalian cell lines such as REH, Nalm6, T47D, HeLa, MCF7 (0, 10, 50, 100, and 250 μM, for 48 h) and Molt4, HEK293T, CEM (0, 0.1, 1, 10, 50 and 100 μM, for 48 h). On incubation with Na-SCR7-P, significant cytotoxicity was observed in case of Molt4, REH, HeLa, T47D and CEM cells [Figure 4]a. However, Nalm6, MCF7, and HEK293T cells exhibited limited sensitivity towards Na-SCR7-P treatment [Figure 4]b. Among the cell lines studied, Molt4, REH, HeLa and T47D showed lower IC50 values [Figure 4]b. Taken together, the cell viability was compromised to varying extents in different cancer cell lines.
Figure 4: Evaluation of effect of sodium salt of SCR7-pyrazine on cell cycle progression and viability of different cancer cells. (a) Effect of sodium salt of SCR7-pyrazine on cell viability and proliferation was assessed by trypan blue assay. REH, Nalm6, T47D, MCF7, HeLa, Molt4, CEM, HEK293T cells were cultured (0.5 × 105 cells/ml) in the presence of sodium salt of SCR7-pyrazine (0, 10, 50, 100 and 250 μM), harvested after 48 h and used for analysis. 1X phosphate buffered saline treated cells were used as vehicle control. Data presented are based on three or more independent experiments, and error bars represent standard error of mean. In all panels, P value represents * P < 0.05; **P < 0.01; ***P < 0.001. (b) Table showing IC50 was calculated post 48 h of treatment using GraphPad Prism 6.0 (Graph Pad, California, San Diago, USA). (c) Sodium salt of SCR7-pyrazine (0, 10, 50, 100, and 250 μM) was added to MCF7 cells and harvested post 48 h of treatment. The cells were stained with propidium iodide and DNA content was quantified by flow cytometry. 1X phosphate buffered saline treated cells served as the vehicle control. For each sample minimum of 10,000 cells were acquired. In each case, M1 represents sub G1 phase, M2 is G1 phase, M3 is S phase, and M4 represents G2/M phase. X-axis corresponds to PI-stained cells. (d) Bar diagram showing the percentage of cells in the sub G1, G1, S, and G2/M phase of the cell cycle obtained after FACS analyses based on three independent repeats

Click here to view


Sodium salt of SCR7-pyrazine induces cell death without causing cell cycle arrest

To determine the effect of Na-SCR7-P on cell cycle progression in cancer cells, MCF7 cells were treated with increasing concentration of the inhibitor. Since MCF7 cells (breast adenocarcinoma) share the same origin as the cancer cells used in our in vivo studies (see below), it was used for subsequent experiments to assess its sensitivity toward Na-SCR7-P. Post 48 h treatment, the cells were harvested and subjected to flow cytometry analysis, following staining with propidium iodide. Results showed that although Na-SCR7-P caused accumulation of cells in the subG1 phase of cell cycle to a considerable extent, there was no significant cell cycle arrest [Figure 4]c and [Figure 4]d. Hence our results suggest that Na-SCR7-P induced apoptosis in cells without inducing cell cycle arrest.

Treatment with sodium salt of SCR7-pyrazine results in reduction in mitochondrial membrane potential

Na-SCR7-P did not elicit substantial production of intracellular ROS in treated MCF7 cells, even post 60 min of treatment at a concentration of 100 μM [Figure 5]a. Cells treated with H2O2 served as a positive control, while PBS (1×) treated cells served as vehicle control [Figure 5]a. However, treatment with Na-SCR7-P resulted in decreased MMP (Δψm) as detected by JC-1 staining followed by FACS analysis [Figure 5]b. Reduction in MMP is an indicator that usually precedes apoptosis. The change in MMP (Δψm) was calculated by analyzing the ratio of red to green fluorescence emitting cells following treatment with Na-SCR7-P. While control cells exhibited red fluorescence indicating an unaltered MMP, a concentration-dependent increase in the green fluorescence was observed indicating loss of intact MMP following Na-SCR7-P treatment [Figure 5]b.
Figure 5: The investigation of the mechanism of cytotoxicity induced by sodium salt of SCR7-pyrazine in cancer cells. (a) The determination of intracellular ROS production in MCF7 cells following treatment with sodium salt of SCR7-pyrazine. Cells treated with sodium salt of SCR7-pyrazine (100 μM) for different time periods (5, 10, 30, and 60 min) were used for assessing the formation of intracellular ROS by flow cytometry. H2O2-treated cells were used as positive control, while cells alone served as negative control. 1X phosphate buffered saline treated cells were used as vehicle control. Cell population showing reactive oxygen species was shown along with standard error mean (n = 2). (b) Evaluation of the effect of sodium salt of SCR7-pyrazine on mitochondrial membrane potential. MCF7 cells were treated with increasing concentrations of sodium salt of SCR7-pyrazine (0, 10, 50, 100, and 250 μM) for 48 h and alteration in mitochondrial membrane potential was assayed using JC-1 staining by flow cytometry. Bar diagram shows a spectral shift from red to green upon treatment. The ratio of red to green fluorescence is represented as bar diagram

Click here to view


Administration of sodium salt of SCR7-pyrazine leads to inhibition of tumor progression and enhancement in survival rate in mouse models

The solid tumor was induced in the thigh region of Swiss albino mice by injecting EAC (Ehrlich ascites breast adenocarcinoma) and DLA cells for evaluating the anticancer potential of Na-SCR7-P. On day 12 post tumor injection, the mice were treated with six doses of Na-SCR7-P (10 mg/kg b. wt. on every alternate day). Significant reduction in tumor progression was observed on treatment with Na-SCR7-P as compared to the untreated tumor control in the case of EAC tumor model [Figure 6]a. The effect was prominent from the 12th day of treatment [Figure 6]a. The reduction in tumor volume was more efficient when treated with Na-SCR7-P as compared to that of SCR7, reported previously.[13] Interestingly, increased survival rate was also observed in Na-SCR7-P treated EAC tumor-bearing mice as compared to the untreated control [Figure 6]b. The administration of Na-SCR7-P, in mice bearing DLA also resulted in inhibition of tumor cell growth, although the effect was much less compared to EAC mice [Figure 6]c. Hence, our results suggest that EAC tumor-bearing mice were more sensitive to tumor growth inhibition by Na-SCR7-P as compared to DLA bearing mice.
Figure 6: Effect of sodium salt of SCR7-pyrazine on the progression of tumor in mouse models and its impact on lifespan. The solid tumor was induced in right thigh region of Swiss albino mice by injecting Ehrlich ascites carcinoma (n = 15) or Dalton's lymphoma (n = 12) cells. Six doses of sodium salt of SCR7-pyrazine (10 mg/kg b. wt.) were administered to tumor-bearing mice (n = 5) every alternate day from the 12th day of tumor cells injection, while the untreated tumor control group (n = 5) received 1X phosphate buffered saline injections every alternate day. (a) Ehrlich ascites carcinoma tumor volume was measured (cu. cm.) following sodium salt of SCR7-pyrazine treatment at regular time intervals and presented along with untreated Ehrlich ascites carcinoma tumor control up to the 20th day. A total of 15 animals comprising untreated tumor-bearing animals (n = 5), sodium salt of SCR7-pyrazine treated tumor animals (n = 5), and no tumor animals (n = 5) were used for the current study. Results presented are from two independent batches. Error bars indicate standard error of mean based on independent experiments. P value represents * P < 0.05; **P < 0.01; ***P < 0.001. (b) Kaplan–Meier survival curves of Ehrlich ascites carcinoma tumor mice treated with sodium salt of SCR7-pyrazine and untreated Ehrlich ascites carcinoma control mice bearing tumor. Five animals per group in duplicates were used for the study. (c) Graph showing tumor volume in mice treated with sodium salt of SCR7-pyrazine. Out of 12, Dalton's lymphoma tumor-bearing animals, 4 served as untreated tumor group, and 4 as sodium salt of SCR7-pyrazine treated tumor-bearing group. Results presented are from two independent batches. Error bars indicate standard error of mean based on independent experiments. P value represents * P < 0.05; **P < 0.01; ***P < 0.001

Click here to view


Analysis of the gross appearance of thigh/tumor, liver and spleen tissues from Na-SCR7-P treated EAC tumor mice revealed a significant reduction in tumor size, resembling tissues from the normal mice, as compared to the tissues from untreated tumor control mice when analyzed on the 25th day after treatment [Figure 7]a. Histological sections of the thigh/tumor and liver tissues stained with Hematoxylin and Eosin showed infiltration of tumor cells in sections from EAC bearing mice. In contrast, restoration of normal muscle and liver cells was observed on treatment with Na-SCR7-P [Figure 7]b. Thus, our results suggest that Na-SCR7-P has the potential to cause regression of tumor, thereby increasing life span of treated mice.
Figure 7: Anatomical and histologic assessment of the effect of sodium salt of SCR7-pyrazine on the progression of tumor in mice and toxicity studies in normal mice. (a) The gross appearance of different organs of normal animals (without tumor), control animals bearing Ehrlich ascites carcinoma tumor and sodium salt of SCR7-pyrazine treated (10 mg/kg) tumor animals on the 25th day of the treatment. (A) thigh tissue of normal mouse, (B) solid tumor tissue, (C) thigh tissue of the sodium salt of SCR7-pyrazine treated mouse, (D) liver from normal mouse, (E) liver of a tumor mouse, (F) liver from sodium salt of SCR7-pyrazine treated mouse, (G) spleen of a normal mouse, (H) spleen of a tumor-bearing mouse, (I) spleen of sodium salt of SCR7-pyrazine treated mouse. (b) Histological analysis of sodium salt of SCR7-pyrazine treated tumor mice. Hematoxylin and Eosin stained sections prepared from either tumor tissues (top) or liver (bottom), with and without treatment of sodium salt of SCR7-pyrazine and normal control animals. (c) Evaluation of side effects of sodium salt of SCR7-pyrazine in normal Swiss Albino mice. Sodium salt of SCR7-pyrazine was administered intraperitoneally (10 mg/kg, six doses every alternate day) to normal (n = 5) and sodium salt of SCR7-pyrazine treated animals (n = 5) and body weight was monitored on the 25th day of treatment. Besides, blood was drawn; plasma and serum were separated, from treated animals along with controls. The serum was analyzed for alkaline phosphatase, creatinine and urea levels. Plasma was also used for counting red blood cells and white blood cells to analyze the side effects. All the values of serum tests and blood counts are given with mean ± standard error of mean (n = 5) and average body weight of each group was plotted with standard error bars. Error bars indicate standard error of mean based on independent experiments. P value represents * P < 0.05; NS: Non-significant

Click here to view


Treatment with sodium salt of SCR7-pyrazine does not lead to significant side effects

To assess the side effects caused by Na-SCR7-P, normal mice were treated with Na-SCR7-P intraperitoneally for 25 days (10 mg/kg b. wt., six doses, every alternate day). 1X PBS was injected into the control group of mice. Results showed no significant difference in body weight on treatment with Na-SCR7-P [Figure 7]c. On the 25th day, the mice were sacrificed, serum and plasma were collected, and subjected to liver and kidney function tests. The data indicated that on treatment, there was no significant change in the levels of ALP, creatinine, RBC, and WBC counts as compared to untreated control mice [Figure 7]c. However, there was a moderate increase in the level of urea, which needs to be investigated. Thus, Na-SCR7-P causes minimal off-target effects in normal healthy mice.

Antiangiogenic potential of sodium salt of SCR7-pyrazine

Enhanced angiogenesis is required for the rapid growth of tumor cells. Antiangiogenic therapeutic strategies have been developed and proven to be effective for the treatment of cancer, with minimal effects on normal cells. In this respect, it was observed that formation of new blood vessels was severely affected, sparing the main blood capillaries developed on the CAM of fertilized chick embryos, when treated with increasing concentrations of Na-SCR7-P (0, 10, 50, 100, and 250 μM) [Figure 8]. In addition, at concentrations of 100 and 250 μM, CAMs in treated eggs also showed bending of main blood vessels in the region of disc placed, indicating the antiangiogenic potential of Na-SCR7-P. However, the mechanism of antiangiogenic properties of SCR7-P needs to be investigated.
Figure 8: Determination of the antiangiogenic effect of sodium salt of SCR7-pyrazine using in ovo chorioallantoic membrane assay. (a) The antiangiogenic effect of sodium salt of SCR7-pyrazine was assessed by placing the filter paper discs (soaked with 10, 50, 100 and 250 μM) on the mesh of blood capillaries in the well-developed chorioallantoic membrane in a 10–12-day-old fertilized embryo. (b) The qualitative estimation of the effect of sodium salt of SCR7-pyrazine on inhibition of formation of new blood vessels was visualized (post 48 h) and captured using Zeiss microscope (Germany). The region where soaked discs were placed is indicated as white circles, with black arrows showing finer neovasculature and blue arrows as the bends of the existing blood capillaries in the region of diffusion of the compound from the discs. (c) The formation of new vasculature in the presence of different concentrations of inhibitor was quantified and represented in the form of histogram with error bars. Error bars indicate standard error of mean based on independent experiments. P value represents *P < 0.05; **P < 0.01; ***P < 0.001

Click here to view



  Discussion Top


Ligase inhibitors in cancer therapy

Recently, small molecule inhibitors were identified that can act against DBD of Ligases which can serve as potential biochemical inhibitors of the various DNA repair process. For example, small molecule inhibitors such as L67 and L189 compete with DNA, for binding to the DBD, whereas L82 inhibits ligation by stabilizing a reaction intermediate.[49] Among them, L82 was specific to DNA Ligase I, L67 was specific to DNA Ligase III, while L189 was effective against all three mammalian ligases.[49] Besides, PBD derivatives that can act against Ligase I were identified recently.[49] More recently, SCR17 and SCR21 were described, which have the ability to block predominantly Ligase I-mediated joining.[39] SCR7 and its different forms were identified based on in silico studies and biochemical assays, which inhibited NHEJ in a Ligase IV-dependent manner.[13],[19] Besides their ability to provide insights into the catalytic mechanisms and cellular process, DNA ligase inhibitors can also be explored for their efficacy to kill cancer cells by blocking endogenous DSB repair. SCR7 is one of the best examples for this.[13],[19] DSBs generated following SCR7 treatment could lead to activation of apoptotic pathways and thus cell death. Previously, we observed that administration of SCR7 inhibited tumor cell progression in breast adenocarcinoma, ovarian and fibrosarcoma mice models, while the effect was minimal in case of DLA model.[13] E-SCR7, a pluronic compound, was observed to be 5-fold more potent in causing cytotoxicity.[14],[15]

Sodium salt of SCR7-pyrazine inhibits nonhomologous end-joining in a Ligase IV-dependent manner

In a recent study, we reported that oxidation of SCR7 could result into a more stable, SCR7-P. Previous studies revealed that parental SCR7, which is least stable, can get spontaneously cyclized into SCR7 and later oxidized to SCR7-P. It was noted that depending on synthesis, storage conditions, etc., SCR7 could exist in multiple cyclized forms.

Interestingly, we observed that similar to SCR7, treatment with SCR-P also resulted in inhibition of NHEJ in a Ligase IV-dependent manner.[19] Both SCR7 and SCR7-P inhibited coding and signal joint formation during V(D) J recombination. Although both SCR7 and SCR7-P treatment resulted in the accumulation of DNA breaks within the cells, only SCR7 revealed Ligase IV-dependent cytotoxicity, suggesting that SCR7-P may have additional targets within the cells.

Water-soluble form of SCR7-pyrazine exhibits improved efficacy of tumor regression

Bioavailability due to drug delivery difficulties and toxicity are the two major issues generally faced by most of the chemical inhibitors. In the present study, we show that sodium salt of SCR7-P is water soluble and can inhibit NHEJ in a Ligase IV-dependent manner. Na-SCR7-P treatment resulted in the reduction of MMP and activation of apoptosis resulting in cytotoxicity at different levels in tested cancer cell lines. Administration of Na-SCR7-P resulted in significant tumor regression in both mouse models studied.[13] Importantly, tumor regression occurred without causing significant side effects. For tumor regression, the formation of new blood vessels needs to be inhibited. Exposure of Na-SCR7-P to CAM showed inhibition of new blood vessel formation in a concentration-dependent manner indicating its antiangiogenic potential. All these results suggest that water-soluble version of SCR7-P is potent and can be used for further investigation.

Although Na-SCR7-P showed inhibition of Ligase IV-mediated joining, it also inhibited both Ligase I and Ligase III mediated in vitro nicked DNA joining. This is indeed a disadvantage for Na-SCR7-P when considered as a biochemical inhibitor of NHEJ due to limited specificity. However, our in vivo tumor animal studies suggest that this may make the molecule more effective in terms of its use in chemotherapy, as the same inhibitor may act against three different targets (DNA Ligase I, III, and IV) in cancer cells. Since DNA ligases in humans have distinct, but overlapping cellular functions in DNA replication of nuclear and mitochondrial genomes, DNA repair and recombination, the use of small molecule inhibitors targeting DNA repair pathways, recombination and DNA replication in cancer cells is considered as a promising new strategy against cancer cell proliferation.[5],[50] In this context, Na-SCR7-P needs to be investigated further to assess its ability to target multiple physiological processes within the cancer cells.

Acknowledgments

We would like to thank M. Nambiar, U. Ray, M. Hegde and other members of SCR laboratory for suggestions and critical reading of the manuscript. NMR facility, Central Animal Facility, and FACS facility of IISc are acknowledged.

Financial support and sponsorship

This work was supported by grants from Centre for the Promotion of Advanced Research (Grant No. IFC/5203-4/2015/131) to SCR and financial assistance from IISc-DBT partnership program (DBT/BF/PR/INS/2011–2012/IISc). MP is supported by Senior Research Fellowship (SRF) from IISc, and VG by SRF from CSIR, New Delhi, India.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Nambiar M, Raghavan SC. How does DNA break during chromosomal translocations? Nucleic Acids Res 2011;39:5813-25.  Back to cited text no. 1
    
2.
Friedberg EC, Aguilera A, Gellert M, Hanawalt PC, Hays JB, Lehmann AR, et al. DNA repair: From molecular mechanism to human disease. DNA Repair (Amst) 2006;5:986-96.  Back to cited text no. 2
    
3.
Helleday T, Petermann E, Lundin C, Hodgson B, Sharma RA. DNA repair pathways as targets for cancer therapy. Nat Rev Cancer 2008;8:193-204.  Back to cited text no. 3
    
4.
Iliakis G, Wang H, Perrault AR, Boecker W, Rosidi B, Windhofer F, et al. Mechanisms of DNA double strand break repair and chromosome aberration formation. Cytogenet Genome Res 2004;104:14-20.  Back to cited text no. 4
    
5.
Srivastava M, Raghavan SC. DNA double-strand break repair inhibitors as cancer therapeutics. Chem Biol 2015;22:17-29.  Back to cited text no. 5
    
6.
Wyman C, Kanaar R. DNA double-strand break repair: All's well that ends well. Annu Rev Genet 2006;40:363-83.  Back to cited text no. 6
    
7.
Lieber MR. The mechanism of double-strand DNA break repair by the nonhomologous DNA end-joining pathway. Annu Rev Biochem 2010;79:181-211.  Back to cited text no. 7
    
8.
Vartak SV, Raghavan SC. Inhibition of nonhomologous end joining to increase the specificity of CRISPR/Cas9 genome editing. FEBS J 2015;282:4289-94.  Back to cited text no. 8
    
9.
Sharma S, Javadekar SM, Pandey M, Srivastava M, Kumari R, Raghavan SC, et al. Homology and enzymatic requirements of microhomology-dependent alternative end joining. Cell Death Dis 2015;6:e1697.  Back to cited text no. 9
    
10.
Deriano L, Roth DB. Modernizing the nonhomologous end-joining repertoire: Alternative and classical NHEJ share the stage. Annu Rev Genet 2013;47:433-55.  Back to cited text no. 10
    
11.
Iliakis G. Backup pathways of NHEJ in cells of higher eukaryotes: Cell cycle dependence. Radiother Oncol 2009;92:310-5.  Back to cited text no. 11
    
12.
Manova V, Singh SK, Iliakis G. Processing of DNA double strand breaks by alternative non-homologous end-joining in hyperacetylated chromatin. Genome Integr 2012;3:4.  Back to cited text no. 12
    
13.
Srivastava M, Nambiar M, Sharma S, Karki SS, Goldsmith G, Hegde M, et al. An inhibitor of nonhomologous end-joining abrogates double-strand break repair and impedes cancer progression. Cell 2012;151:1474-87.  Back to cited text no. 13
    
14.
John F, George J, Srivastava M, Hassan PA, Aswal VK, Karki SS, et al. Pluronic copolymer encapsulated SCR7 as a potential anticancer agent. Faraday Discuss 2015;177:155-61.  Back to cited text no. 14
    
15.
John F, George J, Vartak SV, Srivastava M, Hassan PA, Aswal VK, et al. Enhanced efficacy of pluronic copolymer micelle encapsulated SCR7 against cancer cell proliferation. Macromol Biosci 2015;15:521-34.  Back to cited text no. 15
    
16.
Barnes DE, Stamp G, Rosewell I, Denzel A, Lindahl T. Targeted disruption of the gene encoding DNA ligase IV leads to lethality in embryonic mice. Curr Biol 1998;8:1395-8.  Back to cited text no. 16
    
17.
Ellenberger T, Tomkinson AE. Eukaryotic DNA ligases: Structural and functional insights. Annu Rev Biochem 2008;77:313-38.  Back to cited text no. 17
    
18.
Pascal JM, O'Brien PJ, Tomkinson AE, Ellenberger T. Human DNA ligase I completely encircles and partially unwinds nicked DNA. Nature 2004;432:473-8.  Back to cited text no. 18
    
19.
Vartak SV, Swarup HA, Gopalakrishnan V, Gopinatha VK, Ropars V, Nambiar M, et al. Autocyclized and oxidized forms of SCR7 induce cancer cell death by inhibiting nonhomologous DNA end joining in a ligase IV dependent manner. FEBS J 2018;285:3959-76.  Back to cited text no. 19
    
20.
Chu VT, Weber T, Wefers B, Wurst W, Sander S, Rajewsky K, et al. Increasing the efficiency of homology-directed repair for CRISPR-cas9-induced precise gene editing in mammalian cells. Nat Biotechnol 2015;33:543-8.  Back to cited text no. 20
    
21.
Ma Y, Chen W, Zhang X, Yu L, Dong W, Pan S, et al. Increasing the efficiency of CRISPR/Cas9-mediated precise genome editing in rats by inhibiting NHEJ and using cas9 protein. RNA Biol 2016;13:605-12.  Back to cited text no. 21
    
22.
Maruyama T, Dougan SK, Truttmann MC, Bilate AM, Ingram JR, Ploegh HL, et al. Increasing the efficiency of precise genome editing with CRISPR-cas9 by inhibition of nonhomologous end joining. Nat Biotechnol 2015;33:538-42.  Back to cited text no. 22
    
23.
Ott de Bruin L, Yang W, Capuder K, Lee YN, Antolini M, Meyers R, et al. Rapid generation of novel models of RAG1 deficiency by CRISPR/Cas9-induced mutagenesis in murine zygotes. Oncotarget 2016;7:12962-74.  Back to cited text no. 23
    
24.
Sander JD, Joung JK. CRISPR-cas systems for editing, regulating and targeting genomes. Nat Biotechnol 2014;32:347-55.  Back to cited text no. 24
    
25.
Singh P, Schimenti JC, Bolcun-Filas E. A mouse geneticist's practical guide to CRISPR applications. Genetics 2015;199:1-5.  Back to cited text no. 25
    
26.
Song J, Yang D, Xu J, Zhu T, Chen YE, Zhang J, et al. RS-1 enhances CRISPR/Cas9- and TALEN-mediated knock-in efficiency. Nat Commun 2016;7:10548.  Back to cited text no. 26
    
27.
Yu C, Liu Y, Ma T, Liu K, Xu S, Zhang Y, et al. Small molecules enhance CRISPR genome editing in pluripotent stem cells. Cell Stem Cell 2015;16:142-7.  Back to cited text no. 27
    
28.
Nambiar M, Srivastava M, Gopalakrishnan V, Sankaran SK, Raghavan SC. G-quadruplex structures formed at the HOX11 breakpoint region contribute to its fragility during t(10;14) translocation in T-cell leukemia. Mol Cell Biol 2013;33:4266-81.  Back to cited text no. 28
    
29.
Raghavan SC, Gu J, Swanson PC, Lieber MR. The structure-specific nicking of small heteroduplexes by the RAG complex: Implications for lymphoid chromosomal translocations. DNA Repair (Amst) 2007;6:751-9.  Back to cited text no. 29
    
30.
Sharma S, Panjamurthy K, Choudhary B, Srivastava M, Shahabuddin M, Giri R, et al. Anovel DNA intercalator, 8-methoxy pyrimido[4',5':4,5]thieno (2,3-b) quinoline-4(3H)-one induces apoptosis in cancer cells, inhibits the tumor progression and enhances lifespan in mice with tumor. Mol Carcinog 2013;52:413-25.  Back to cited text no. 30
    
31.
Srivastava M, Hegde M, Chiruvella KK, Koroth J, Bhattacharya S, Choudhary B, et al. Sapodilla plum (Achras sapota) induces apoptosis in cancer cell lines and inhibits tumor progression in mice. Sci Rep 2014;4:6147.  Back to cited text no. 31
    
32.
Srivastava S, Somasagara RR, Hegde M, Nishana M, Tadi SK, Srivastava M, et al. Quercetin, a natural flavonoid interacts with DNA, arrests cell cycle and causes tumor regression by activating mitochondrial pathway of apoptosis. Sci Rep 2016;6:24049.  Back to cited text no. 32
    
33.
Thomas E, Gopalakrishnan V, Somasagara RR, Choudhary B, Raghavan SC. Extract of vernonia condensata, inhibits tumor progression and improves survival of tumor-allograft bearing mouse. Sci Rep 2016;6:23255.  Back to cited text no. 33
    
34.
Lokman NA, Elder AS, Ricciardelli C, Oehler MK. Chick chorioallantoic membrane (CAM) assay as an in vivo model to study the effect of newly identified molecules on ovarian cancer invasion and metastasis. Int J Mol Sci 2012;13:9959-70.  Back to cited text no. 34
    
35.
Xiao X, Zhou X, Ming H, Zhang J, Huang G, Zhang Z, et al. Chick chorioallantoic membrane assay: A 3D animal model for study of human nasopharyngeal carcinoma. PLoS One 2015;10:e0130935.  Back to cited text no. 35
    
36.
Sathees CR, Raman MJ. Mouse testicular extracts process DNA double-strand breaks efficiently by DNA end-to-end joining. Mutat Res 1999;433:1-3.  Back to cited text no. 36
    
37.
Kumar TS, Kari V, Choudhary B, Nambiar M, Akila TS, Raghavan SC, et al. Anti-apoptotic protein BCL2 down-regulates DNA end joining in cancer cells. J Biol Chem 2010;285:32657-70.  Back to cited text no. 37
    
38.
Sharma S, Choudhary B, Raghavan SC. Efficiency of nonhomologous DNA end joining varies among somatic tissues, despite similarity in mechanism. Cell Mol Life Sci 2011;68:661-76.  Back to cited text no. 38
    
39.
Pandey M, Kumar S, Goldsmith G, Srivastava M, Elango S, Shameem M, et al. Identification and characterization of novel ligase I inhibitors. Mol Carcinog 2017;56:550-66.  Back to cited text no. 39
    
40.
Chen X, Pascal J, Vijayakumar S, Wilson GM, Ellenberger T, Tomkinson AE, et al. Human DNA ligases I, III, and IV-purification and new specific assays for these enzymes. Methods Enzymol 2006;409:39-52.  Back to cited text no. 40
    
41.
Tadi SK, Sebastian R, Dahal S, Babu RK, Choudhary B, Raghavan SC, et al. Microhomology-mediated end joining is the principal mediator of double-strand break repair during mitochondrial DNA lesions. Mol Biol Cell 2016;27:223-35.  Back to cited text no. 41
    
42.
Chiruvella KK, Kari V, Choudhary B, Nambiar M, Ghanta RG, Raghavan SC, et al. Methyl angolensate, a natural tetranortriterpenoid induces intrinsic apoptotic pathway in leukemic cells. FEBS Lett 2008;582:4066-76.  Back to cited text no. 42
    
43.
Shahabuddin MS, Nambiar M, Choudhary B, Advirao GM, Raghavan SC. A novel DNA intercalator, butylamino-pyrimido[4',5':4,5]selenolo(2,3-b) quinoline, induces cell cycle arrest and apoptosis in leukemic cells. Invest New Drugs 2010;28:35-48.  Back to cited text no. 43
    
44.
Hegde M, Karki SS, Thomas E, Kumar S, Panjamurthy K, Ranganatha SR, et al. Novel levamisole derivative induces extrinsic pathway of apoptosis in cancer cells and inhibits tumor progression in mice. PLoS One 2012;7:e43632.  Back to cited text no. 44
    
45.
Kavitha CV, Nambiar M, Ananda Kumar CS, Choudhary B, Muniyappa K, Rangappa KS, et al. Novel derivatives of spirohydantoin induce growth inhibition followed by apoptosis in leukemia cells. Biochem Pharmacol 2009;77:348-63.  Back to cited text no. 45
    
46.
Kumar S, Gopalakrishnan V, Hegde M, Rana V, Dhepe SS, Ramareddy SA, et al. Synthesis and antiproliferative activity of imidazo[2,1-b][1,3,4]thiadiazole derivatives. Bioorg Med Chem Lett 2014;24:4682-8.  Back to cited text no. 46
    
47.
Chiruvella KK, Sebastian R, Sharma S, Karande AA, Choudhary B, Raghavan SC, et al. Time-dependent predominance of nonhomologous DNA end-joining pathways during embryonic development in mice. J Mol Biol 2012;417:197-211.  Back to cited text no. 47
    
48.
Gu J, Lu H, Tippin B, Shimazaki N, Goodman MF, Lieber MR, et al. XRCC4:DNA ligase IV can ligate incompatible DNA ends and can ligate across gaps. EMBO J 2007;26:1010-23.  Back to cited text no. 48
    
49.
Chen X, Zhong S, Zhu X, Dziegielewska B, Ellenberger T, Wilson GM, et al. Rational design of human DNA ligase inhibitors that target cellular DNA replication and repair. Cancer Res 2008;68:3169-77.  Back to cited text no. 49
    
50.
Tomkinson AE, Howes TR, Wiest NE. DNA ligases as therapeutic targets. Transl Cancer Res 2013;2. pii: 1219.  Back to cited text no. 50
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7], [Figure 8]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
References
Article Figures

 Article Access Statistics
    Viewed335    
    Printed54    
    Emailed0    
    PDF Downloaded87    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]