• Users Online: 44
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2017  |  Volume : 8  |  Issue : 4  |  Page : 168-173

Beta radiation induces apoptosis in human histiocytic lymphoma cells


Radiopharmaceuticals Division, Bhabha Atomic Research Centre, Mumbai, Maharashtra, India

Date of Web Publication8-Jan-2018

Correspondence Address:
Dr. Chandan Kumar
Radiopharmaceuticals Division, Bhabha Atomic Research Centre, Mumbai, Maharashtra
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jrcr.jrcr_35_17

Rights and Permissions
  Abstract 

Objective: Lu-177 has a great potential for use as theranostics radiopharmaceuticals for management of cancer, evidenced by its increasing use over the past decade in nuclear medicine. The detail mechanisms of cell toxicity induced by the beta-radiation emitted from Lu-177 are not well understood. Hence, to explore the lurking mechanism of cell death, different parameters were assessed after treatment of human histiocytic lymphoma cells (U937) with Lu-177. Materials and Methods: U937 cells (1 × 106) were exposed to 3.7 and 37 MBq of Lu-177 and incubated for 24 and 48 h in humidified CO2incubator. The cell viability and apoptosis were estimated in treated and control cells by trypan blue dye exclusion and electrophoretic DNA ladder assay, respectively. Reverse transcriptase polymerase chain reaction was carried out to study the expression of anti-apoptotic genes. Results: It was found that the cell death and apoptosis were high in the cells which were exposed for a longer duration of time with 37MBq of Lu-177. These results were further confirmed by observation of downregulation of anti-apoptotic genes such as BCL-2 and BCLXL. Conclusion: It is concluded from the study that the Lu-177 induced apoptotic cell death in human histiocytic lymphoma cells by downregulation of anti-apoptotic genes.

Keywords: Anti-apoptotic gene, apoptosis, cell death, Lu-177, U937


How to cite this article:
Kumar C. Beta radiation induces apoptosis in human histiocytic lymphoma cells. J Radiat Cancer Res 2017;8:168-73

How to cite this URL:
Kumar C. Beta radiation induces apoptosis in human histiocytic lymphoma cells. J Radiat Cancer Res [serial online] 2017 [cited 2018 Jul 22];8:168-73. Available from: http://www.journalrcr.org/text.asp?2017/8/4/168/222440


  Introduction Top


The availability of radionuclides with suitable properties for theranostics uses and the advent of target-specific molecules usher to rapid increase in the use of radionuclides in health-care management. High energy particulate radiation plays an important role in achieving the therapeutic effectiveness of radionuclide therapy. Although beta particles, which are equivalent to electrons, are less ionizing than alpha particles, being lighter, they have a longer range. The long range of the emitted electrons leads to irradiation of cells in its path, achieving destruction of a large number of cells around the vicinity of localized radionuclides. Thus, unlike radionuclides with very short range which require localization of the radionuclide in each cell for killing, while, beta particles can have far higher reach for destroying the cancer cells around it. Such cross-fire effect would obviate the necessity of the radiotherapeutic agent to be present within each of the targeted cells. The high specific radioactivity production of Lu-177 from medium flux reactor with sufficient T1/2 of 6.73 d and maximum beta particles energy of 490 keV, along with imageable gamma of 208 keV (11%), made it the choicest radionuclides to the nuclear medicine physician for bone pain palliation and other tumor-targeted therapies.[1]

Several beta-emitting radioisotopes are being used for therapy as well as bone pain palliation.[1],[2],[3],[4],[5],[6],[7] Radioisotopes such as 32P and 89Sr are used as simple inorganic form for bone pain palliation. 32P is taken up by cancerous tissues while 89Sr has high affinity to bone.[5],[6] Radioisotopes of iodine such as 123I, 124I, 125I, and 131I are taken up by differentiated thyroid tissues.[8] Other beta emitters such as 177Lu, 90Y, 188Re, and 153Sm have been coupled to antibodies or peptides or other molecules and used in the therapy of different types of cancer, metastatic pain management, and other diseases.[1],[2],[3],[4],[5],[6],[7] Beta radiation emitted from radionuclide induces cell death affecting various cell signaling pathways.[9],[10],[11],[12],[13],[14],[15],[16],[17],[18],[19],[20] The survivals of cells are overseen by the anti- and pro-apoptotic regulator proteins of the BCL-2 gene family.[21] Anti-apoptotic genes such as BCL2 and BCLXL get downregulated in contrary to pro-apoptotic genes during apoptosis. Apoptotic cell death can be detected through the characteristic DNA ladder[22] and by employing several techniques such as flow cytometry and Western blotting.[11],[12],[13],[14],[15], [16,[17],[18],[23]

Mechanism regarding the mode of cell death induced by beta-emitting radionuclides is not well understood. Since Lu-177 is fast gaining importance as a therapeutic radionuclide for treatment of different types of cancers, it will be interesting to know the mode of cell death induced by the radionuclide. In this study, an attempt was made to find the mode of cell death induced by Lu-177 in human histiocytic lymphoma cell line (U937). Cells were exposed to beta radiation emitted from Lu-177, and different parameters were evaluated to study the mechanism of apoptotic cell death.


  Materials and Methods Top


Materials

Chemicals for cell culture and assays were obtained from Sigma Chemical Inc. (USA). The “apoptotic DNA ladder kit” was procured from Roche Diagnostics GmbH (Indianapolis, IN, USA). PerfectPure RNA Cultured Cell Kit and Masterscript kits were procured from 5 PRIME Inc (Gaithersburg, MD, USA). U937, a human histiocytic lymphoma cell line, was obtained from the National Center for Cell Sciences, Pune, India. Lu-177 was obtained from Radiochemical Section, Radiopharmaceuticals Division, Bhabha Atomic Research Centre, Mumbai, Maharashtra, India. Purity of RNA and its concentration was measured in JASCO V-530 UV/VIS spectrophotometer. UVITEC Gel Documentation System (UVItec Limited Cambridge UK) was used to grab photograph of gel containing amplified DNA, and densitometry analysis was carried out with UVIband map software (UVItec Limited Cambridge UK).

Cell culture

U937 cells were cultured in RPMI-1640, supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad CA, USA), and 1% antibiotic/antimycotic solution. All cells were grown at 37°C in humidified 5% CO2-containing incubator.

Irradiation of tumor cells and dosimetry

U937 cells were harvested and seeded in 6-well plates at a density of 1 × 106 cells per well in 5 ml media. The cells were cultured at 37°C in a humidified atmosphere with 5% CO2. Two different amounts (3.7 and 37 MBq) of high specific radioactivity of 177LuCl3 at pH 6 were added to avoid colloid formation without dropping the pH lower to 7.4. Cells were incubated for 24 and 48 h in serum-free culture media. Cells were harvested after respective time points and used to carry out different assays. Dose delivered by Lu-177 was calculated assuming that the energy deposited in the media by the beta particles was 100% while it was negligible for the gamma rays.[16]

Study of cell viability

Cells were harvested after incubation of Lu-177 for 24 and 48 h, washed thoroughly, and resuspended in media. Magnitudes of cell death in control and treated cells were estimated by trypan blue dye exclusion assay. In brief, the cells were mixed with equal volume of 0.4% w/v trypan blue dye and incubated for 2 min in a microcentrifuge tube. Live and dead cells were counted using a hemocytometer under a microscope. Trypan blue dye was taken up by the dead cells while the living cells exclude it. Percentage cell viability was calculated as a ratio of live cells to the total cells multiplied by 100.

Study of apoptosis by DNA ladder assay

Treated and control cells were lysed to isolate DNA following the protocol described in apoptotic DNA ladder kit. In brief, cell pellets were resuspended in 200 μL of PBS and 200 μL of lysis buffer was added. Samples were mixed and incubated for 10 min. Subsequently, 100 μL of isopropanol was added and mixed on a vortex. The filter tube and collection tube were combined, and the samples were loaded separately onto the upper reservoir of different tubes. The tubes were centrifuged at 10,000 × g for 1 min. The process was repeated twice and the flowthrough was discarded. A fresh collection tube was inserted and prewarm (+70°C) elution buffer (provided with kit) was added, which was centrifuged at 10,000 × g for 1 min. The supernatant containing DNA was collected and stored at − 20°C for further use. The isolated DNA was loaded onto 1% agarose gel containing ethidium bromide, and electrophoresis was carried out in tris-borate ethylenediaminetetraacetic acid buffer. Photograph of gel was captured using UVITEC gel documentation system.

Reverse transcriptase polymerase chain reaction for expression analysis of anti-apoptotic genes

Isolation and characterization of RNA

Total RNA was isolated from the control and irradiated cells, following protocol provided with “PerfectPure RNA Cultured Cell Kit.” Briefly, cells were harvested and lysed by addition of 400 μL of cell lysis buffer. The cell lysates were transferred to column and centrifuged at 13,000 × g for 1 min, followed by washing with wash buffer. DNase was added to the column and incubated for 10 min and washed twice with both DNase wash buffer and wash-2 buffer. The RNA was eluted from the column by addition of elution buffer in it followed by centrifugation at 13,000 × g for 1 min. RNA was quantified by spectrophotometer (A260/A280 >1.8) and stored at −80°C (in small aliquots) for longer storage.

Semiquantitative reverse transcription-polymerase chain reaction

The complementary DNA (cDNA) synthesis was carried out following the procedure described in the Masterscript Kit. Briefly, for each sample, reverse transcriptase (RT) enzymes, deoxynucleotide triphosphates mix, oligo (dT)18 primer, RT buffer, and 0.5 μg of RNA were mixed and subjected to one-step polymerase chain reaction (PCR) amplification at 55°C for 60 min. Then, cDNA samples were subjected to PCR amplification using sequence-specific forward and reverse primers (ACTIN F-5'gatcattgctcctcctgagc3', ACTIN R-5'aaagccatgccaatctcatc3' BCL-2 F 5'ctccta atttttactccctctccc3' BCL-2 R 5'atcctctgtcaagtttcctttttg3' BCLXLF-5'cccttcagaatcttatcttggct3' BCLXLR 5'ggga aagcttgtaggagagaaag3'). The annealing temperatures of the primers were determined by gradient PCR subjected to amplification at different temperatures. The PCR program was set up after standardization for optimum Tm. Initial template denaturation at 94°C for 2 min followed by 30 cycles each of 15 s of template denaturation at 94°C, primer annealing at 58°C for 20 s and primer elongation at 72°C for 30 s, and final elongation at 72°C for 5 min were the optimum PCR condition for amplifications. PCR-amplified DNA was resolved by agarose gel electrophoresis (2% agarose gel containing ethidium bromide) using TBE buffer. Photograph of agarose gel containing DNA was grabbed using UVItec gel documentation system. Individual band intensity of DNA was quantified using UVIband map software. Gene expression was analyzed by taking ratio of band intensity of anti apoptotic gene to the beta actin gene of same sample.

Statistical analysis

The results are mean ± standard deviation of at least three independent experiments, where t-test was used to compare control and treated samples. To test the hypothesis, P ≤ 0.05 was considered statistically significant.


  Results Top


Calculation of radiation dose delivered by beta radiation

Radiation dose delivered by beta radiation emitted from Lu-177 to the cells was calculated using the values for Eβavg of Lu-177 as 0.1329 MeV, residence time of 86,400 s (24 h) and 172,800 s (48 h), radioactivity are 3.7 and 37 MBq and volume of cells 5 mL (~5 g). The absorbed dose of 3.7 MBq of Lu-177 for 24 and 48 h is 1.35 and 2.71 Gy, respectively, while for 37 MBq of Lu-177, the absorbed dose is 13.59 and 27.18 Gy. Thus, the dose rate of Lu-177 for 3.7 and 37 MBq was calculated as 0.0009437 and 0.009437 Gy/min, respectively.

Effect of irradiation and cell viability

Cell viability studies were carried out after irradiation of cells with Lu-177 radioactivity. [Figure 1] shows the percentage cell viability in relation to the time as well as amount of radioactivity to which the cells were exposed. At 6 h of exposure, the viability remained at >80% at 37 MBq of radioactivity. Viability of U937 cells exposed to 3.7 MBq of radioactivity for 24 and 48 h was decreased to ~60% and ~50%, respectively. Similarly, cells exposed to 37 MBq of radioactivity for 24 and 48 h, the viability was again decreased to ~55% and ~40%, respectively.
Figure 1: Estimation of percentage cell viability of U937 cells treated with 3.7 and 37 MBq radioactivity of 177LuCl3 for 24 and 48 h. Where * and ** indicate significant differences between control and treated samples analyzed by t-test with P < 0.01, respectively

Click here to view


Effects of irradiation on apoptotic cell death

Apoptotic cell death was estimated by electrophoretic DNA ladder assay [Figure 2]. Results showed that the DNA ladder was more prominent in cells irradiated with 37 MBq of radioactivity for 48 h, compared to the 24 h treated cells. In both periods (24 and 48 h) of irradiation, cells treated with 37 MBq showed more prominent appearance of the DNA ladder in comparison to the cells that were treated with 3.7 MBq of Lu-177 radioactivity. No ladder was found in un-irradiated control cells [Figure 2]. Positive control (camptothecin-treated U937 cells) was used to compare the DNA ladder while marker was used to compare the molecular weight of fragmented DNA ladder.
Figure 2: Apoptotic DNA ladder assay of U937 cells treated with 3.7 and 37 MBq radioactivity of 177LuCl3 for 24 and 48 h (where, M − marker DNA, +Ve C − positive control cell treated with camptothecin and C − control cell without treatment)

Click here to view


Effect of beta irradiation on expression of anti-apoptotic genes in U937

RT-PCR was carried out to semiquantify the expression of genes in control and treated cells. Expression of anti-apoptotic gene BCL2 and BCLXL has been compared with the housekeeping gene β-actin [Figure 3]a. Densitometry was carried out by quantifying individual DNA band intensity and expressed as ratio of BCL2/ACTIN and BCLXL/ACTIN [Figure 3]b and c]. It is confirmed from [Figure 3] that expression of both the genes BCL2 and BCLXL is downregulated with the increase in the amount of radioactivity and the time of exposure. Downregulation of BCL2 in samples irradiated with 37 MBq radioactivity of Lu-177 for 48 h is comparatively more than 24 h. Downregulation of BCLXL was also observed in 48 h treatment with both 3.7 and 37 MBq radioactivity, whereas in the case of 24 h irradiation, this observation was predominant only in cells exposed to 37 MBq, which is far less for 3.7 MBq of radioactivity. It was found that the expression of BCL2 and BCLXL decreases with the increase in time as well as amount of radioactivity.
Figure 3: (a) Expression of β-actin, BCL2, and BCLXL genes after treatment of U937 cells with 3.7 and 37 MBq radioactivity of 177LuCl3 for 24 and 48 h (where, C – control cell without treatment). (b) Densitometry analysis of expression of BCL2 gene after treatment of U937 cells with 3.7 and 37 MBq radioactivity of 177LuCl3 for 24 and 48 h expressed as ratio of band intensity of BCL-2/β-ACTIN (where, C – control cell without treatment). Where * and ** indicate significant differences between control and treated samples analyzed by t-test with P < 0.01, respectively. (c) Densitometry analysis of expression of BCLXL gene after treatment of U937 cells with 3.7 and 37 MBq radioactivity of 177LuCl3 for 24 and 48 h expressed as ratio of band intensity of BCLXL/βACTIN (where, C – control cell without treatment). Where * and ** indicate significant differences between control and treated samples analyzed by t-test with P < 0.05, respectively

Click here to view



  Discussion Top


The effect of radiation on biological systems depends on the dose, dose rate, energy, and nature of emitted radiations.[24] The high LET radiation causes severe damage conversely with low LET radiation. The penetration range of beta of Lu-177 in tissue is few millimeters. Considering the geometry of well plate, we expect 100% deposition of beta energy in culture media and gamma rays escape from the same. Since the effect of gamma rays was assumed to be negligible and most of the effect was due to beta radiation only. Hence, it was very interesting to study the effect of emitted beta radiation from Lu-177.. Most of the radiopharmaceuticals are administered through intravenous and it encountered through the blood cells. Thus, it is imperative to choose human histiocytic lymphoma tumor cells to study the effect of beta radiation emitted from the Lu-177. Lu-177 in chloride form has high affinity toward the bone matrix which is undesirable and hence it should be labeled with targeted molecules to deliver the cytotoxic dose of beta radiation to the target site (diseased sites).[25] For this study, human histiocytic lymphoma cells were irradiated with beta radiation emitted from Lu-177 and several parameters were assessed. Here, the effect was due to non-internalized Lu-177 in U937 cell line. The dose rate of Lu-177 is very low; however, the cell toxicity was 40%–60% up to 48 h treatment with two dose rate of radioactivity. This indicates that the cumulative effect of Lu-177 over time is the cause of damage of cells which was estimated by trypan blue dye. DNA ladder assay which is the characteristic of apoptosis confirmed the fragmentation of DNA. RT-PCR was carried out to study the expression of anti-apoptotic genes and the downregulation of BCL2 and BCLXL confirmed the apoptotic cell death.[21] Our results are in agreement with the previous study showing that beta radiation is a potent inducer of apoptosis,[9],[10],[11],[12],[13],[14],[15],[16],[17],[18],[19],[20] suggesting apoptotic cell death induced by Lu-177 radionuclides.


  Conclusion Top


It is concluded that the beta radiation emitted from Lu-177 radionuclide induce apoptotic cell death in human histiocytic lymphoma which involved the downregulation of BCL2 family member of anti-apoptotic genes. Further studies are needed to trace the DNA damage and apoptotic signaling pathway of beta emitting therapeutic radionuclides.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
  References Top

1.
Banerjee S, Pillai MR, Knapp FF. Lutetium-177 therapeutic radiopharmaceuticals: Linking chemistry, radiochemistry, and practical applications. Chem Rev 2015;115:2934-74.  Back to cited text no. 1
    
2.
Braat AJ, Smits ML, Braat MN, van den Hoven AF, Prince JF, de Jong HW, et al. 90Y hepatic radioembolization: An update on current practice and recent developments. J Nucl Med 2015;56:1079-87.  Back to cited text no. 2
[PUBMED]    
3.
Thapa P, Nikam D, Das T, Sonawane G, Agarwal JP, Basu S, et al. Clinical efficacy and safety comparison of 177Lu-EDTMP with 153Sm-EDTMP on an equidose basis in patients with painful skeletal metastases. J Nucl Med 2015;56:1513-9.  Back to cited text no. 3
    
4.
Maini CL, Bergomi S, Romano L, Sciuto R. 153Sm-EDTMP for bone pain palliation in skeletal metastases. Eur J Nucl Med Mol Imaging 2004;31 Suppl 1:S171-8.  Back to cited text no. 4
    
5.
Finlay IG, Mason MD, Shelley M. Radioisotopes for the palliation of metastatic bone cancer: A systematic review. Lancet Oncol 2005;6:392-400.  Back to cited text no. 5
    
6.
Lewington VJ. Bone-seeking radionuclides for therapy. J Nucl Med 2005;46 Suppl 1:38S-47S.  Back to cited text no. 6
    
7.
Chinol M, Vallabhajosula S, Goldsmith SJ, Klein MJ, Deutsch KF, Chinen LK, et al. Chemistry and biological behavior of samarium-153 and rhenium-186-labeled hydroxyapatite particles: Potential radiopharmaceuticals for radiation synovectomy. J Nucl Med 1993;34:1536-42.  Back to cited text no. 7
    
8.
Boelaert K, Franklyn JA. Sodium iodide symporter: A novel strategy to target breast, prostate, and other cancers? Lancet 2003;361:796-7.  Back to cited text no. 8
    
9.
Kumar C, Korde A, Kumari KV, Das T, Samuel G. Cellular toxicity and apoptosis studies in osteocarcinoma cells, a comparison of 177Lu-EDTMP and lu-EDTMP. Curr Radiopharm 2013;6:146-51.  Back to cited text no. 9
    
10.
Kumar C, Pandey BN, Samuel G, Venkatesh M. Cellular internalization and mechanism of cytotoxicity of 131I-rituximab in raji cells. J Environ Pathol Toxicol Oncol 2013;32:91-9.  Back to cited text no. 10
    
11.
Lim SJ, Kim EH, Woo KS, Chung WS, Choi CW, Lim SM, et al. Induction of G2 arrest and apoptosis of raji cells by continuous low-dose beta irradiation with 188Re-perrhenate. Cancer Biother Radiopharm 2006;21:314-20.  Back to cited text no. 11
    
12.
Eriksson D, Blomberg J, Lindgren T, Löfroth PO, Johansson L, Riklund K, et al. Iodine-131 induces mitotic catastrophes and activates apoptotic pathways in heLa hep2 cells. Cancer Biother Radiopharm 2008;23:541-9.  Back to cited text no. 12
    
13.
Meng Z, Lou S, Tan J, Xu K, Jia Q, Zheng W, et al. Nuclear factor-kappa B inhibition can enhance apoptosis of differentiated thyroid cancer cells induced by 131I. PLoS One 2012;7:e33597.  Back to cited text no. 13
    
14.
Friesen C, Lubatschofski A, Kotzerke J, Buchmann I, Reske SN, Debatin KM, et al. Beta-irradiation used for systemic radioimmunotherapy induces apoptosis and activates apoptosis pathways in leukaemia cells. Eur J Nucl Med Mol Imaging 2003;30:1251-61.  Back to cited text no. 14
    
15.
Kumar C, Vats K, Lohar SP, Korde A, Samuel G. Camptothecin enhances cell death induced by (177)Lu-EDTMP in osteosarcoma cells. Cancer Biother Radiopharm 2014;29:317-22.  Back to cited text no. 15
    
16.
Kumar C, Jayakumar S, Pandey BN, Samuel G, Venkatesh M. Cellular and molecular effects of beta radiation from I-131 on human tumor cells: A comparison with gamma radiation. Curr Radiopharm 2014;7:138-43.  Back to cited text no. 16
    
17.
Kumar C, Pandey BN, Samuel G, Venkatesh M. Doxorubicin enhances (131)I-rituximab induced cell death in raji cells. J Cancer Res Ther 2015;11:823-9.  Back to cited text no. 17
    
18.
Kumar C. Studies with beta particle emitting radionuclide for cancer therapy. Germany: LAP LAMBERT Academic Publishing, Omni Scriptum GmbH & Co. KG; 2017.  Back to cited text no. 18
    
19.
Kumar C, Samuel G. Iodine-131 induces cell death by downregulation of antiapoptotic genes in MCF-7 human adenocarcinoma cells. J Radiat Cancer Res 2017;8:103-7.  Back to cited text no. 19
  [Full text]  
20.
Sharma R, Kumar C, Mallia MB, Kameswaran M, Sarma HD, Banerjee S, et al. In vitro evaluation of 188Re-HEDP: A Mechanistic view of bone pain palliations. Cancer Biother Radiopharm 2017;32:184-91.  Back to cited text no. 20
    
21.
Cory S, Huang DC, Adams JM. The Bcl-2 family: Role in cell survival and oncogenesis. Oncogene 2003;22:8590-607.  Back to cited text no. 21
    
22.
Daniel PT, Sturm I, Ritschel S, Friedrich K, Dörken B, Bendzko P, et al. Detection of genomic DNA fragmentation during apoptosis (DNA ladder) and the simultaneous isolation of RNA from low cell numbers. Anal Biochem 1999;266:110-5.  Back to cited text no. 22
    
23.
Elmore S. Apoptosis: A review of programmed cell death. Toxicol Pathol 2007;35:495-516.  Back to cited text no. 23
    
24.
Kumar C, Shetake N, Desai S, Kumar A, Samuel G, Pandey BN, et al. Relevance of radiobiological concepts in radionuclide therapy of cancer. Int J Radiat Biol 2016;92:173-86.  Back to cited text no. 24
    
25.
Taylor DM, Leggett RW. A generic biokinetic model for predicting the behaviour of the lanthanide elements in the human body. Radiat Prot Dosimetry 2003;105:193-8.  Back to cited text no. 25
    


    Figures

  [Figure 1], [Figure 2], [Figure 3]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Figures

 Article Access Statistics
    Viewed209    
    Printed6    
    Emailed0    
    PDF Downloaded27    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]