• Users Online: 174
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2017  |  Volume : 8  |  Issue : 2  |  Page : 103-107

Iodine-131 induces cell death by downregulation of antiapoptotic genes in MCF-7 human adenocarcinoma cells


Bhabha Atomic Research Centre, Radiopharmaceuticals Division, Mumbai, Maharashtra, India

Date of Web Publication14-Jun-2017

Correspondence Address:
Chandan Kumar
Bhabha Atomic Research Centre, Radiopharmaceuticals Division, Mumbai, Maharashtra
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jrcr.jrcr_20_17

Get Permissions

  Abstract 


Aims: Radioiodine (131I) is the most common radionuclide which possesses favorable nuclear characteristics for targeted therapy in cancer management. There are several therapeutic radiopharmaceuticals labeled with 131I used in clinics, but the basic mechanism describing the cause of induced cell death is limited in literature. Hence, the aim of the present study is to find a plausible mechanism of cellular toxicity and involvement of antiapoptotic gene in induction of cell death due to 131I. Materials and Methods: The effect of 131I on cell death was studied by incubating MCF-7 cell line with different amount of 131I radioactivity for 6 h followed by washing and extended the incubation for 48 h. Cells were harvested and cell viability was assessed by lactate dehydrogenase (LDH) release and trypan blue dye uptake. Apoptosis study was carried out with enzyme-linked immunosorbent assay method. Reverse transcriptase polymerase chain reaction was carried out to find expression of antiapoptotic genes, viz., BCL-2 and BCLXL. Results: It was found that release of LDH was Dose and time dependent, and 35% cell death was estimated by trypan blue with 37 MBq of 131I radioactivity at 48 h of incubation. Enrichment factor of apoptotic DNA was 3.2 with 37 MBq of 131I at 48 h. Densitometric analysis of BCL-2 and BCLXLshowed that there is downregulation of genes expression, which confirmed apoptotic cell death. Conclusions: 131I induces apoptosis in MCF-7 cell line by the downregulation of antiapoptotic gene BCL-2 and BCLXLwhen exposed for longer time periods.

Keywords: Apoptosis, BCL-2, BCLXL, lactate dehydrogenase, radioiodine


How to cite this article:
Kumar C, Samuel G. Iodine-131 induces cell death by downregulation of antiapoptotic genes in MCF-7 human adenocarcinoma cells. J Radiat Cancer Res 2017;8:103-7

How to cite this URL:
Kumar C, Samuel G. Iodine-131 induces cell death by downregulation of antiapoptotic genes in MCF-7 human adenocarcinoma cells. J Radiat Cancer Res [serial online] 2017 [cited 2017 Aug 20];8:103-7. Available from: http://www.journalrcr.org/text.asp?2017/8/2/103/208024


  Introduction Top


Radioiodine (131I) is one of the earliest known radionuclides used in therapy, particularly for thyroid disorder, as they are taken up by the differentiated thyroid tissues.[1] It emits beta-, gamma-, as well as X-rays with a physical half-life of 8.04 days.[2] Its maximum range of beta in air is 165 cm, while in tissue, average range is 2.3 mm.[3],[4] The scope of applications of 131I increased tremendously due to simple method of labeling of biomolecules and without significantly affecting the biological properties of the parent molecules. Thus, radioiodinated antibodies and other biomolecules are being widely used in the therapy of different cancers.[5],[6],[7] The mechanisms regarding cell death induced by β-particle emitting radionuclide are not well known. However, few articles described the mechanism of cell death in thyroid, lymphoma, and HeLa Hep2 cancer cells.[8],[9],[10],[11] In this study, mechanism of cell death induced by 131I has been described. In general, regulated cell death occurs in organism through apoptosis which is governed by extrinsic and intrinsic signaling pathways.[12] Ionizing radiation induces stress and encourages cell death by means of apoptosis.[13],[14],[15],[16] The survival or death of a cell is largely determined by the BCL-2 family of anti- and pro-apoptotic regulator proteins.[17] There are several methods available for the detection of cell death; however, to investigate the mechanism of cell death induced by continuous irradiation, we exposed breast adenocarcinoma cell line (MCF-7) to 131I and cellular toxicity was studied by lactate dehydrogenase (LDH) and trypan dye uptake. Apoptotic DNA fragmentations were estimated by enzyme-linked immunosorbent assay (ELISA) method while expressions of antiapoptotic genes by reverse transcriptase polymerase chain reaction (RT-PCR). Here, we report apoptotic cell death induced by 131I in MCF-7 cell line.


  Materials and Methods Top


Materials

All bulk fine chemicals for cell culture work were obtained from Sigma-Aldrich Inc., USA, unless and otherwise stated in the text.

Cell culture

MCF-7 cell line, obtained from the National Centre for Cell Sciences, Pune, India, were cultured in Dulbecco's modified Eagle's media supplemented with 10% fetal bovine serum (Gibco), 2 mM, L-glutamine, and 1% antibiotic/antimycotic solution. All cell culture was undertaken at the normal atmospheric oxygen concentration in 5% humidified CO2 atmosphere of incubator at 37°C temperature.

Cell irradiation

MCF-7 cells were harvested from culture and seeded in 25 mm culture flask at a density of 0.5 × 106 cells and incubated at 37°C overnight. Different amounts (0.37, 1.85, 3.7, 18.5, and 37 MBq) of 131I were incubated for 6 h in serum-free culture medium. Cells were washed thrice with phosphate-buffered saline and further incubated for 24 and 48 h in complete media. After completion of incubation period, cells were harvested and experiments regarding estimations of cell death and apoptosis were carried out.

Lactate dehydrogenase release assay

After completion of 6 h time period of incubation, supernatant culture medium was collected after centrifugation to estimate the release of LDH. The LDH assay was carried out according to the protocol described in the kit. In brief, LDH assay mixture was prepared by mixing equal volume of LDH assay substrate, co-factor, and dye. The reaction mixture was added with culture media (2:1, v/v) in a 96-well plate. They were mixed well and covered with aluminum foil to protect from light and incubated for 25 min at room temperature. The reaction was terminated by adding 1/10th volume of 1 N HCl and absorbance was measured at 490 nm. The percent release of LDH was calculated as (optical density [OD] of treated sample/OD of control sample) ×100.

Viability assay by trypan blue

MCF-7 cells were washed thrice after completion of 6 h of incubation and again incubated for 24 and 48 h in culture media. These cells were harvested after trypsinization and cell viability was determined by counting cells in the tenth volume of 0.4% trypan blue dye. Living cells excludes the dye while dead cells take up the dye, which was counted in a hemocytometer under horizontal microscope and expressed as percent cells death. The percentage viability was calculated as ratio of live and total cells multiplied by 100.

Apoptotic DNA fragmentation study

For determination of magnitude of apoptosis, DNA fragmentation study was carried out according to the protocol described in in situ cell death detection ELISA kit. Briefly, MCF-7 cells (~1 × 105 cells) harvested after completion of treatment, lysed using cytoplasmic lysis buffer for 30 min, and centrifuged to 20,000 g for 10 min. Supernatant was carefully transferred to new tubes and stored at −40°C until analysis. ELISA plate was coated overnight at 4°C with anti-histone antibody, followed by incubation of 100 μl of cell lysates for 90 min. Thereafter, the wells were washed thrice and incubated with anti-DNA-horse radish peroxidase for 90 min. The wells were again washed thrice, and substrate solution was added and incubated for 20 min until the color developed, which was quantified at 405 nm. DNA fragmentation was expressed as enrichment factor which is the ratio of OD of treated and control sample.

Reverse transcriptase polymerase chain reaction for expression analysis of antiapoptotic gene

Total RNA isolation

Total RNA was isolated by 5-PRIME RNA isolation kit procured from Eppendorf, GmbH, Germany, following the manufacturer's instruction. Briefly, cells were lysed in 400 μl of cell lysis buffer by repeated pipetting of lysate which was transferred to column and centrifuge at 12,800 g for 1 min following washing with wash buffer. Subsequently, DNase was added, incubated for 10 min, and washed with DNase wash buffer. The column was again washed with wash-2 buffer. The RNA was eluted by adding elution buffer in the column which was centrifuged for a minute. The quality of RNA was determined by a spectrophotometer where the ratio of A260 and A280 is more than 1.8. RNA was stored at −20°C for immediate use or kept at −80°C (in small aliquots) for further use.

Semi-quantitative reverse transcriptase-polymerase chain reaction

The first step RT reaction was carried out by following the procedure of 5-PRIME RT-PCR kit (Eppendorf, Germany) with 0.5 μg of RNA for every reaction. The incubation program for first-strand complementary DNA (cDNA) synthesis (RT) with oligo (dT)18 primer was carried at 55°C for 60 min. Then, cDNA samples were subjected to PCR amplification using sequence-specific forward and reverse primers (actin F-5'gatcattgctcctcctgagc3', actin R-5'aaagccatgccaatctcatc3', BCL-2 F5'ctcctaatttttactccctctccc3' BCL-2 R5'atcctctgtcaagtttcctttttg3' BCLXLF-5'cccttcagaatcttatcttggct3' BCLXLR5'gggaaagcttgtaggagagaaag3') according to the 5-PRIME PCR kit (Eppendorf, Germany). The PCR program was set up as follows after standardization, initial template denaturation at 94°C for 2 min followed by thirty cycles each of template denaturation at 94°C for 15 s, primer annealing at 58°C for 50 s, primer elongation at 72°C for 50 s, and final elongation at 72°C for 5 min. The annealing temperature was determined by gradient PCR subjected to different temperature of annealing. The amplified PCR product was resolved by gel electrophoresis (2% agarose gel) using tris-borate electrophoresis buffer. The DNA bands were visualized under ultraviolet light after staining with ethidium bromide, and gel photographs were taken using Uvitec Gel documentation system (Cambridge, UK). Gene expression was measured by quantifying band intensity by UVI-BAND MAP software (UVItec Limited, Cambridge, UK) and data were expressed as a ratio of gene specific primer to the β-actin of the same sample as an endogenous control.

Statistical methods

Results are presented as mean±standard deviation, statistical analysis was performed using the t-test, and P < 0.05 was considered statistically significant, mentioned in results.


  Results Top


Cellular toxicity study by lactate dehydrogenase release assay

LDH enzyme generally flushed out from cells if there is membrane damage. Since amount of LDH release is proportional to the cell membrane damage, it is used as an indicator of cell toxicity. It was found that increasing the concentration of 131I radioactivity increased cell toxicity and ~16% cell toxicity was observed in the case of 37 MBq of 131I activity incubated for 6 h [Figure 1]. From this experiment, 3.7 and 37 MBq of 131I concentration were selected for further studies which were incubated for 24 and 48 h time periods.
Figure 1: Percent release of lactate dehydrogenase from MCF-7 cells incubated with 131I for 6 h

Click here to view


Cell viability by trypan blue dye uptake

Cells were washed thoroughly after incubation of 3.7 and 37 MBq of 131I radioactivity for 6 h, followed by incubation for 24 and 48 h. Cell viability was determined after completion of 24 and 48 h of incubation, which is depicted in [Figure 2]. It was found that cell viability was less when cells were incubated with 37 MBq of 131I for 24 and 48 h compared to 3.7 MBq (P < 0.01) and control cells (P < 0.001). Cell death was <10% in 6 h and was equivalent to the cell death percentage observed in 3.7 MBq of 131I activity incubated for 24 h.
Figure 2: Percent cell death of MCF-7 cells by trypan blue dye exclusion assay, incubated with 131I for 6 h followed by incubation for 24 and 48 h which was analyzed with t-test and P < 0.05

Click here to view


Apoptotic DNA fragmentation study

Cells were harvested after 24 and 48 h, and apoptosis study was carried out by the ELISA method. It was found that DNA fragmentation [Figure 3] increases with the increase in time of incubation from 6 to 48 h, in either case of amount of 131I. However, enrichment factor increases from 1.5 to 2.25 at 24 h (P < 0.05) incubation, while in the case of 48 h, this factor increases from 1.75 to 3.25 (P < 0.01).
Figure 3: Apoptotic DNA fragmentation of MCF-7 cells incubated with 131I for 6 h followed by incubation for 24 (P < 0.05) and 48 h (P < 0.01)

Click here to view


Expression analysis of antiapoptotic gene

Expression of antiapoptotic gene BCL-2 and BCLXL has been depicted in [Figure 4]. It has observed that expression of both the genes BCL-2 and BCLXL was downregulated with increase in amount of radioactivity and time of exposure. Downregulation of BCL-2 and BCLXL in 48 h is significantly high than in 24 h irradiation with 37 MBq radioactivity of 131I. Expression analysis of antiapoptotic gene of BCL-2 [Figure 5] and BCLXL [Figure 6] has depicted graphically as a ratio of BCL-2/ACTIN and BCLXL/ACTIN. It was found that this ratio decreases with time of incubation and amount of radioactivity added (P < 0.05). Expression analysis of BCL-2 in 24 and 48 h of 131I incubation with 37 MBq showed downregulation as compared to the 3.7 MBq (P < 0.05) of radioactivity. Similar trends of expression were observed in the case of BCLXL at 48 h with 37 MBq 131I radioactivity in comparison to 3.7 MBq (P < 0.05) radioactivity.
Figure 4: Antiapoptotic gene expression of MCF-7 cells incubated with 131I for 6 h followed by incubation for 24 and 48 h

Click here to view
Figure 5: Relative expression of BCL-2 gene in MCF-7 cells incubated with 131I for 6 h followed by incubation for 24 (P < 0.05) and 48 h (P < 0.05)

Click here to view
Figure 6: Relative expression of BCLXL gene in MCF-7 cells incubated with 131I for 6 h followed by incubation for 24 and 48 h (P < 0.05)

Click here to view



  Discussion Top


Radionuclide therapy is an emerging area of treatment modality in nuclear medicine; however, lack of radiobiological data has limited its use to thyroid disorder and certain cancers only.[18] Since radioiodine has been used for thyroid cancer for more than seven decades; recently, researchers have tried to delineate DNA damage, apoptosis, and various signaling pathways for better understanding of the therapeutic potential.[8],[9],[10],[11],[19] Here too, such a mechanism of 131I-induced cell death on breast adenocarcinoma cell line was studied. Since average penetration range of beta of 131I in tissue is ~2.3 mm, we expect 100% deposition of beta energy in culture media and gamma rays may escape from the same.[4] Hence, the effect of gamma rays was assumed to be negligible and most of the effect was due to beta radiation only. Radioiodine is taken up by various tissues expressing sodium iodide symporter.[1],[20] MCF-7 cell line does not contain sodium iodide symporter and previously reported by author that sodium iodide uptake in this cell line is negligible.[8] The effect of 131I with and without internalization in the cells may differ. Since internalized radionuclides are in close proximity to the nucleus, damage of DNA will be more compared to the membrane-bound radionuclides, resulted more cell toxicity.[21] In this study, effect was due to non-internalized 131I in MCF-7 cell line. Cellular toxicity studies by LDH assay clearly indicates that [Figure 1] amount of released LDH remains constant during incubation of 0.37–3.7 MBq of 131I for 6 h; however, there is a sudden increase in LDH after incubation of 18.5 MBq of 131I in cells with 16% zenith. This might be due to radiation adaption of cell at such low amount of radioactivity where radiation resistance mechanisms are predominant. However, at higher radioactivity >18.5 MBq of 131I, such mechanisms fail to prevent cell damage. Cell viability was estimated using 3.7 and 37 MBq 131I radioactivity up to 48 h [Figure 2] by trypan blue dye and found that cell death is proportional to the dose and the time of irradiation. Similarly, apoptosis study by estimation of DNA fragmentation also confirms the cell death which depends on incubation time and amount of 131I. Although the values of cell death estimated by LDH, trypan blue dye exclusion and DNA fragmentation assay are different; however, the basic patterns are quite similar. Such differences in the quantitative estimation values are due to difference in the sensitivity of the assay.[8],[22],[23] To establish the apoptotic pathway as the cause of cell death, quantification of antiapoptotic genes were carried which confirmed downregulation of BCL-2 and BCLXL gene. Up to 24 h of incubation, both genes showed significant (P < 0.05) downregulation in comparison to control, which was further increased at 48 h (P < 0.01) time period. Since the downregulations of BCL-2 and BCLXL are responsible for apoptotic cell death,131I radioactivity induces apoptotic pathway for cell death in MCF-7 cell line.[17] The gene expression study also reveals that BCL-2 is more radio-responsive than the BCLXL gene, because at 24 h time period of incubation, BCLXL gene expressions are significantly less compared to BCL-2 gene expression at the similar time point. The half-life and energy of a radionuclide are the hallmarks for the identification of same. Unless the radionuclide has similar energy and half-life compared to 131I, the effect of β-emitting 131I radionuclide on MCF-7 cannot be generalized for any other beta emitting radionuclides.


  Conclusions Top


Beta-emitting 131I radionuclide induces apoptotic cell death in breast adenocarcinoma cell line. This apoptotic cell death depends on the amount of radioactivity and time of exposure, which involves the downregulation of antiapoptotic genes of which BCL-2 is more responsive to radiation stress than the BCLXL. Further studies are desirable to trace the apoptotic signaling pathway by same radionuclides.

Acknowledgment

We would like to thank Mr. P. V. Joshi of the Radiopharmaceuticals Division, Bhabha Atomic Research Centre, for providing in-house Na 131I to carry out these studies. Authors would also thank Dr. Meera Venkatesh former Head Radiopharmaceuticals Division, Bhabha Atomic Research Centre, to allow carrying out this work.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
  References Top

1.
Boelaert K, Franklyn JA. Sodium iodide symporter: A novel strategy to target breast, prostate, and other cancers? Lancet 2003;361:796-7.  Back to cited text no. 1
[PUBMED]    
2.
Kocher DC. Radioactive Decay Data Tables. DOE/TIC-11026. Springfield: National Technical Information Service; 1981.  Back to cited text no. 2
    
3.
Irving K. Nuclear Physics. New York: Addison-Wesley; 1964.  Back to cited text no. 3
    
4.
Wheat JM, Currie GM, Davidson R, Kiat H. Radionuclide therapy. Radiographer 2011;58:53.  Back to cited text no. 4
    
5.
Mach JP, Carrel S, Merenda C, Sordat B, Cerottini JC.In vivo localisation of radiolabelled antibodies to carcinoembryonic antigen in human colon carcinoma grafted into nude mice. Nature 1974;248:704-6.  Back to cited text no. 5
[PUBMED]    
6.
Pohlman B, Sweetenham J, Macklis RM. Review of clinical radioimmunotherapy. Expert Rev Anticancer Ther 2006;6:445-61.  Back to cited text no. 6
[PUBMED]    
7.
Sgouros G. Update: Molecular radiotherapy: Survey and current status. Cancer Biother Radiopharm 2008;23:531-40.  Back to cited text no. 7
[PUBMED]    
8.
Kumar C, Jayakumar S, Pandey BN, Samuel G, Venkatesh M. Cellular and molecular effects of beta radiation from I-131 on human tumor cells: A comparison with gamma radiation. Curr Radiopharm 2014;7:138-43.  Back to cited text no. 8
[PUBMED]    
9.
Kumar C, Pandey BN, Samuel G, Venkatesh M. Doxorubicin enhances 131I-rituximab induced cell death in Raji cells. J Cancer Res Ther 2015;11:823-9.  Back to cited text no. 9
[PUBMED]    
10.
Meng Z, Lou S, Tan J, Xu K, Jia Q, Zheng W. Nuclear factor-kappa B inhibition can enhance apoptosis of differentiated thyroid cancer cells induced by 131I. PLoS One 2012;7:e33597.  Back to cited text no. 10
[PUBMED]    
11.
Eriksson D, Blomberg J, Lindgren T, Löfroth PO, Johansson L, Riklund K, et al. Iodine-131 induces mitotic catastrophes and activates apoptotic pathways in HeLa Hep2 cells. Cancer Biother Radiopharm 2008;23:541-9.  Back to cited text no. 11
    
12.
Elmore S. Apoptosis: A review of programmed cell death. Toxicol Pathol 2007;35:495-516.  Back to cited text no. 12
[PUBMED]    
13.
Haimovitz-Friedman A. Radiation-induced signal transduction and stress response. Radiat Res 1998;150 5 Suppl:S102-8.  Back to cited text no. 13
    
14.
Li L, Story M, Legerski RJ. Cellular responses to ionizing radiation damage. Int J Radiat Oncol Biol Phys 2001;49:1157-62.  Back to cited text no. 14
[PUBMED]    
15.
Szumiel I. Ionizing radiation-induced cell death. Int J Radiat Biol 1994;66:329-41.  Back to cited text no. 15
[PUBMED]    
16.
Harms-Ringdahl M, Nicotera P, Radford IR. Radiation induced apoptosis. Mutat Res 1996;366:171-9.  Back to cited text no. 16
[PUBMED]    
17.
Cory S, Huang DC, Adams JM. The Bcl-2 family: Roles in cell survival and oncogenesis. Oncogene 2003;22:8590-607.  Back to cited text no. 17
[PUBMED]    
18.
Kumar C, Shetake N, Desai S, Kumar A, Samuel G, Pandey BN, et al. Relevance of radiobiological concepts in radionuclide therapy of cancer. Int J Radiat Biol 2016;92:173-86.  Back to cited text no. 18
    
19.
Hertz S, Roberts A. Radioactive iodine as an indicator in thyroid physiology. Am J Physiol 1940;128:565.  Back to cited text no. 19
    
20.
Harun-Or-Rashid M, Asai M, Sun XY, Hayashi Y, Sakamoto J, Murata Y. Effect of thyroid statuses on sodium/iodide symporter (NIS) gene expression in the extrathyroidal tissues in mice. Thyroid Res 2010;3:3.  Back to cited text no. 20
[PUBMED]    
21.
Kumar C, Pandey BN, Samuel G, Venkatesh M. Cellular internalization and mechanism of cytotoxicity of 131I-rituximab in Raji cells. J Environ Pathol Toxicol Oncol 2013;32:91-9.  Back to cited text no. 21
[PUBMED]    
22.
Skoog ML, Ollinger K, Skogh M. Microfluorometry using fluorescein diacetate reflects the integrity of the plasma membrane in UVA-irradiated cultured skin fibroblasts. Photodermatol Photoimmunol Photomed 1997;13:37-42.  Back to cited text no. 22
[PUBMED]    
23.
Pandey BN, Mishra KP. In vitro studies on radiation induced membrane oxidative damage in apoptotic death of mouse thymocytes. Int J Low Radiat 2003;1:113.  Back to cited text no. 23
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusions
References
Article Figures

 Article Access Statistics
    Viewed95    
    Printed8    
    Emailed0    
    PDF Downloaded26    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]